|
ABSTRACTS Arranged in alphabetical order by first author
Speciation in ancient Lake Ohrid – freshwater limpets of the genus Ancylus
Albrecht, Christian*1, Streit, Bruno1, Kuhn, Kerstin1, Pfenninger, Markus1, Schultheiß, Roland1, Gerhardt, Miriam1, Trajanovski Sasho2, & Wilke, Thomas3 1. Department of Ecology and Evolution, J.W. Goethe-University Frankfurt, Siesmayerstr. 70, D-60054 Frankfurt, Germany. Email: Christian.Albrecht@zoology.uni-frankfurt.de 2. Department of Zoobenthos, Hydrobiological Institute Ohrid (HBI), Naum Ohridski 50, Ohrid, Republic of Macedonia 3. Department of Animal Ecology and Systematics, Justus Liebig University Giessen, Heinrich-Buff-Ring 26-32 (IFZ), D-35392 Giessen, Germany.
Ancient lakes like Lake Ohrid on the Balkan Peninsula have long been recognized as evolutionary theaters and hot spots of endemism; they provide prime models for the study of in situ evolution. Extraordinarily shaped endemic freshwater limpets of the genus Ancylus of lake Ohrid were regarded as paleoendemics or relictary species. We studied the two endemic species, A. scalariformis and A. tapirulus, using mitochondrial (COI, 16S) and nuclear (ITS-1) genetic markers to determine phylogenetic relationships between the Ohrid endemics and other European Ancylus species. The analyses show that the endemic lake Ohrid Ancylus species form a monophyletic group. However, nucleotide divergences between the lake Ohrid species and other taxa are relatively low and preliminary molecular clock analyses indicate that the Ohrid species are phylogenetically younger than the assumed geological age of the lake. The data indicate an intralacustrine origin from a single invasion of the lake and a rapid evolution of the distinct "ancient" shell structure and shape of Ohrid species. Therefore, A. tapirulus and A. scalariformis can not be regarded as relicts. This assumption is also supported by the incomplete reciprocal monophyly inferred in the ITS-1 analysis due to incomplete lineage sorting.A combination of spatial isolation, patchiness and low mobility of ancylid populations could have triggered intralacustrine speciation. Further studies will focus on the selective regimes like small-scale ecological differences, predation and sexual selection.
A molecular phylogenetic perspective on the evolution of freshwater pulmonate snails (Basommatophora) Albrecht, Christian*1, Wilke, Thomas2, Kuhn, Kerstin1, & Streit, Bruno1 1. Department of Ecology and Evolution, J.W. Goethe University Frankfurt, Siesmayerstr. 70, D-60054 Frankfurt, Germany. Email: Christian.Albrecht@zoology.uni-frankfurt.de 2. Department of Animal Ecology and Systematics, Justus Liebig University Giessen, Heinrich-Buff-Ring 26-32 (IFZ), D-35392 Giessen, Germany. The order Basommatophora represents a large and diverse group of predominantly limnic pulmonate gastropods that are distributed worldwide. Members of the most widespread and species-rich families Lymnaeidae and Planorbidae are of immense economic and public health importance. In order to identify major phylogenetic groups within the Basommatophora, to clarify relationships between and within putative families, to define origin and age of lineages, and to establish hypotheses of freshwater basommatophoran evolution, we used two independent molecular markers; mitochondrial cytochrome c subunit I DNA and nuclear small subunit rRNA (18S rRNA) with a total of 2348 base pairs. The previously recognized superfamilies of Basommatophora s. str. formed highly supported monophyletic groups in our analysis. The short branch length of the splits between Acroloxoidea, Planorboidea and Physoidea/Lymnaeoidea suggests a nearly simultaneous divergence of these lineages. The families Acroloxidae, Physidae, Bulinidae, Lancidae and Lymnaeidae were found to be well-supported monophyla as well. The Ancylidae and Planorbidae, however, were not monophyletic and clustered within the Planorboidea. A sister-group relationship of Physidae and Lymnaeidae was well supported in our analyses. Previously, such a relationship was never considered in hypotheses based on morphological data. Contradictory to the commonly held view that patelliform Basommatophora are derived groups, it appears that freshwater limpets (e.g. Burnupia, Acroloxidae, Lanx) represent ancestral forms in several independent lineages of the Basommatophora. Evolutionary pathways and systematic implications are discussed based on the robust and comprehensive phylogeny inferred in our study.
"Atlas of Antarctic Mollusca" - towards a monograph of molluscs south of the convergence Allcock, Louise1, Engl, Winfried2, Linse, Katrin3, Martynov, Alexander4, Piatkowski, Uwe5, Schwabe, Enrico2, Schrödl, Michael2, Sirenko, Boris6, Vecchione, Michael7, & Wägele, Heike*8 1 Queen’s University Belfast, Belfast, UK. Email: l.allcock@qub.ac.uk2 Zoologische Staatssammlung München, Münchhausenstr. 21, 81247 München, Germany; Emails: w.engl@gmx.de; schroedl@zi.biologie.uni-muenchen.de; Enrico.Schwabe@zsm.mwn.de3 British Antarctic Survey, Cambridge, UK. Email: kl@bas.ac.uk4 Zoological Museum, Moscow State University, Moskow, Russia; Email: martynov@zmmu.msu.ru5 Institut für Meereskunde, Düsternbrooker Weg 20, D-24105 Kiel, Germany; Email: upiatkowski@ifm.uni-kiel.de6 Zoological Institute, Russian Academy of Sciences, St. Petersburg, Russia; Email: marine@zin.ru7 Systematics Lab., National Museum of Natural History, Washington DC, USA; Email: vecchione.michael@nmnh.si.edu8 Lehrstuhl für Zoologie, Ruhr-Universität Bochum, Germany; Heike.Waegele@ruhr-uni-bochum.deOur book-project is an attempt to cover the biodiversity of extant Mollusca from Antarctic waters south of the convergence, from the intertidal to the deep sea, with special emphasis on the Weddell Sea, Scotia Sea including South Sandwich, and Antarctic Peninsula. A multi-author approach (Engl & Schrödl, eds) with experts for all molluscan subgroups (classes) shall achieve 1) to include and pleasantly document as many species as possible (> 500), 2) to guarantee high scientific quality over the various groups, 3) to make species accurately identifiable for non-specialists, i.e. to provide a fully illustrated guide to Antarctic Mollusca. For our new book, vast museum material and specimens collected during various Antarctic expeditions, mainly the ANT XV, XVII-3, XIX-3-5 expeditions with RV "Polarstern", have been examined. So far, 10 polyplacophoran, 2 monoplacophoran, 4 scaphopod, 68 bivalve, 370 gastropod and 33 cephalopod species have been revised and illustrated. Type material of 260 species already has been re-examined, with regard to many species for the first time. Taxonomically problematic groups such as the gastropod genus Prosipho are revised also considering subantarctic species. Up to now we found more than 30 new synonyms, and even more Antarctic species still are to be described as new ones. Our new information will significantly supplement and update Dell’s book on (shelled) Antarctic Mollusca that was focused on the Ross Sea. The "Atlas of Antarctic Mollusca" (ConchBooks; scheduled for late 2004) is intended to become a standard work of molluscs south of the convergence.
Geographical distribution patterns of land snails of Western Ghats, India Aravind N. A. 1*, Rajashekhar K. P.2 and Madhaystha, N.A. 3 1 Ashoka Trust for Research in Ecology and the Environment (ATREE), #659 5th A Main, Hebbal, Bangalore-560024, India. Email: aravind@atree.org2 Department of Applied Zoology, Mangalore University, Mangalagangothri-574119, Dakshina Kannada District, India3 Co-ordinator, Malacology Centre, Poorna Prajna College, Udupi-576101, India
Patterns of geographical distribution of birds, amphibians, fishes and plants are well known for Western Ghats, India, which is a biodiversity hotspot. However, invertebrate taxa have received cursory attention in addressing their distribution pattern. Here we analyse the geographical distribution pattern for land snails of Western Ghats. To address the above problem, we digitized the published records from various sources and also included our own field data in to database. Our analysis reveals that, of the 265 recorded species 75 % of the land snails were endemic to Western Ghats. A majority of the endemic species occur in the southern Western Ghats between latitudes of 080 N to 120 N. 56% of the 210 species recorded from the southern Western Ghats, were endemic, whereas central (120 N to 160 N) and Northern Western Ghats (160 to 210 N) has 16 % and 26 % endemic species respectively. Species richness shows a south - north gradient with the richness decreasing towards the north. This may be because of high rainfall, shorter dry periods and climatic variability in the southern part of Western Ghats. We have identified three areas of high species richness and endemic species richness. The species-rich areas are a) Nilgiris-Annamalais-Palni hills-Travancore region in Southern Western Ghats, b) South Kanara-North Kanara region in Central Western Ghats and c) Mahabaleshwar-Khandala-Poona region in Northern Western Ghats. Much of the endemic land snail distribution, like that of birds and plants, is found at mid to high altitudes. We have also developed the species richness map using GIS technique. Geographical distribution pattern of land snails with the amphibians, fishes and endemic plants of Western Ghats is compared.
The H3/H4 Histone gene cluster as new molecular marker in land snail evolution and phylogeny Armbruster, G.F.J. Dep. Integrative Biology, Section of Conservation Biology, University of Basel, St. Johanns Vorstadt 10, CH - 4056 Basel, Switzerland, Email: g.armbruster@unibas.ch
In eukaryotes, histone genes H3 and H4 provide proteins for the chromosome architecture. There is presently no information about the histone gene evolution of land snails (Stylommatophora). Following primers were developed to amplify the H3-spacer-H4 gene cluster of the Stylommatophora: F1 TTCTGGTAAGGACGGATCTC and F2 GTGCTCTTCTGGTAACGACG (nested in the H3 gene; as forward primers) and R1 AGGGCRTAGACRACATCCAT and R2 TCGGTGTAGGTGACGGCATC (nested in the H4 gene; as reverse primers). Primer combination F2 / R2 worked best in PCR. Eventually, the gene cluster was cloned and sequenced for 18 land snail species. Transcription of the H3 and H4 genes was divergent as in other protostomes and diploblast animals, but differed from Mytilus (bivalves) with transcription in the same direction. Phylogenetic implications: (i) The coding parts of H3 and H4 nucleotide regions were concatenated (i.e. 354 bp) and were used for sequence trees, with an elasmognath sequence as outgroup. The helicoid gastropod Trichia villosa formed a basal branch. The Cochlicopidae, Vertiginidae and Valloniidae appeared paraphyletic. The latter three families were reevaluated using ribosomal DNA (rDNA) sequencing (as in the work of Wade, Mordan & Clarke: 2001). The rDNA trees also support these families as paraphyletic. Orthurethrous land snails, usually presumed as monophyletic, could also be a paraphyletic group. Tentative evidence was found that endodontid and clausiliid gastropods could have a common ancestor although they differ strongly in kidney anatomy and shell morphology. (ii) The non-coding and non-transcribed spacer region varied between 279 and 691 bp. In future, this spacer should be tested as a tool in systematics of closely related species.
Global management of the natural and economic resource "Terrestrial Snails" in Spain: Conservation and sustainable exploitation Arrébola, J.R., Ruiz, A., Cárcaba, A. & Gómez, B*. Dpto. Fisiología y Zoología. Fac. Biología. Univ. de Sevilla. Avda. Reina Mercedes, 6. 41012-Spain. Email: mastus@us.es In spite of terrestrial snails are wild animals that play basics functions in nature, they must bear, like other zoological groups, the human pressure that hazards their conservation status. In certain countries, they are also a natural resource longed exploited, whose importance come from the fact they are a rich protein food, an individual money incoming, the cause of gastronomic, social and cultural celebrations and even the support of really important snail markets. In this sense, the potential development of heliciculture must also be considered. Most of the actions undertaken in the world to care about terrestrial snails, generally apply biologics and environmental views, forgetting the social, economical and cultural scopes of the resource. In this communication, the strategy adopted in Spain (Andalusia), a country with a long malacological tradition, is presented. It is a versatile and multivariable perspective that not only considers the basic biology and the species natural history, but it includes motivations, customs, social and politics aspects, local interests... around the molluscs, on the base that community involved must participate in future planning to achieve the goals. A regulated and socioeconomic stable "helicicola" sector is pursuing, and its sustainable development will base on decisions that respect, preserve and keep customs and traditions, at the same time they guarantee the conservation of the malacological diversity. On this purpose, different investigation lines are carrying on with the Program for Conservation and Sustainable Snail Exploitation in Andalusia (the most extensive and "helicicola" traditional region in the country) funded by the autonomic government. A synthesis of the results actually achieved on terrestrial malacofauna catalogue, the helicicola activity, the life history of consumed species, the regulation of the exploitation, the promotion of heliciculture and the divulgation of general results constitute this communication. The objective is to promote the discussions and the exchange of ideas and results of other countries with similar initiatives, as well as to propose future collaborations.
Recruitment in populations of freshwater pearl mussels (Margaritifera margaritifera) in relation to population size and host density Arvidsson, B.* and Karlsson, J. Division of Environmental Sciences, Department of Biology, Karlstad University, SE 651 88 Karlstad, Sweden. Email: bjorn.arvidsson@kau.se In a study we examined the relationship between successful recruitment in populations of freshwater pearl mussels, and mussel population size and host density. The freshwater pearl mussel has declined seriously during the last hundred years, probably due to anthropogenic reasons, and many populations are not viable today. Environmental factors may act directly on mussel survival or indirectly through effects on its host, salmonid fishes (Salmo sp.). Our analyses indicate that both mussel population size and host density have a significant effect on recruitment probability of mussels. The negative effect of population size on recruitment probability may be caused by low survival of glochidia larvae in small, declining populations due to anthropogenic sedimentation. Modern forestry practices have led to a leakage of fine sediments to streams, causing an anaerobe environment in the sediments leading to suffocation of larvae during the juvenile stage when mussels are buried in the sediment. Another possibility is that declining and small populations may suffer from negative effects of inbreeding. We also predicted a negative relation between mussel recruitment and densities of young brown trout (Salmo trutta) since they are more sensitive than older trout to glochidia infection. However, no such correlation was found. Instead we found a strong negative correlation with the densities of old trout. The reason for this may be that the density of young trout vary more annually, making an eventual correlation difficult to observe in our data set. There was a significant correlation between densities of old and young trout indicating that densities of old trout are a good indicator of reproductive success in trout.
Sinistral variants suffer mating disadvantage despite facultative mating success with dextral majority in the pond snail Lymnaea stagnalis Asami, Takahiro*1, Takayama, Miho1 , Utsuno, Hiroki1 & Gittenberger, Edmund2 1 Department of Biology, Shinshu University, Matsumoto 390-8621, Japan. Email: asami99@shinshu-u.ac.jp2 National Museum of Natural History, P. O. Box 9517, NL-2300 RA Leiden, The NetherlandsThe left-right polarity of spiral cleavage corresponds to the bilateral asymmetry of anatomy, as well as to the coiling direction in pulmonates. The handedness of entire body architecture is determined by the maternal genotype at a single nuclear locus. The classical example of interchiral cross in Lymnaea peregra has demonstrated delayed inheritance of handedness and mating success between the dextral and sinistral morphs (Boycott & Diver, 1923). However, neither the mating behavior of sinistrals nor their relative mating success with dextrals have not been ever examined in Lymnaea. We have established sinistral and dextral lines of L. stagnalis, which originate in a single wild population and has an advantage of large body size allowing easier behavioral analysis. Using the two morphs, we answered three questions: 1) Does the sinistral perform left-right reversed courtship? 2) How does the sinistral copulate with the dextral? 3) Is their interchiral mating as easy as the ordinary intrachiral mating? First, we found that the sinistral variant court a partner in the reversed polarity. It was clear especially in the left-right asymmetric circling in courtship. Second, against our expectation based on the examples of interchiral mating trials known so far, the two morphs performed flexible modifications of mating behavior for extraordinary orientations that allow interchiral copulation. Third, comparison with intrachiral pairs indicated that interchiral pairs significantly more frequently fails in copulation. The present study demonstrates that positive frequency-dependent selection occurs against sinistral variants despite their behavioral capability of interchiral copulation in water.
Genetic variability and phylogeographical patterns of the invasive species Dreissena polymorpha
Astanei, Iulian & Gosling, Elizabeth* Molecular Ecology Research Group, Galway-Mayo Institute of Technology, School of Science, Galway, Ireland. Email: elizabeth.gosling@gmit.ie
Dreissena polymorpha (Pallas) is an invasive mussel indigenous to the Caspian Sea, but has spread throughout most of Europe and eastern North America. The mussel was first reported in Ireland in the lower Shannon system in 1997, but was probably introduced in 1994 or even earlier. The zebra mussel has spread rapidly up the Shannon system and its connecting canals. The source population(s) of Irish zebra mussels is at present unknown. Ten selected populations from Ireland (Limerick, Lough Derg, Lough Key, Assaroe, Dublin), England (London Docks), Holland (Meuse River), Romania (Prut River) and N. America (Lake Ontario and Lake St. Claire) were tested for genetic heterogeneity at five trinucleotide microsatellite loci. Heterozygosity levels observed in Irish populations were well within the range obtained for European and Great Lakes populations, suggesting that the Irish founder population(s) were large, or that there were several introductions after foundation. Significant heterozygote deficiencies were observed at all five loci, which could be interpreted as evidence for population subdivision and local inbreeding within populations. Tests for linkage disequilibrium failed to show significant disequilibria between any microsatellite locus pair. Comparisons between Irish, European and North American populations indicated little differentiation between Irish and English populations, most likely reflecting an English origin for Irish zebra mussels. The clustering of Lake St. Claire, where zebra mussels were first reported in North America, with the sample from the Netherlands suggests a potential founding population from North-West Europe, rather than from Central Europe. The Romanian population (considered to be a native site for zebra mussels), while divergent from all locations, was closer to Lake Ontario than to any other population.
Sensory cues in foraging land snails Bailey, S.E.R. ‘Bill’ School of Biological Sciences, 3.614 Stopford Building, The University of Manchester, M139PT, UK. Email: bbailey@fs1.scg.man.ac.uk Chemical sensitivity dominates the behavioural responses of snails and slugs. It has been the basis of much applied research into the foraging and feeding behaviour of species which are crop pests. Chemical cues are involved in orientation to food and as feeding stimulants or deterrents. They are also involved in trail following, homing and courtship. However, apart from vision, the non-chemical responses have been largely ignored. The eyes are directionally sensitive light-gathering devices, with few retinal elements and a fish-eye lens. Helix aspersa show some visual acuity: they turn the body or tentacles to follow a moving pattern and can be conditioned to avoid an electric shock in a T-maze by choosing a chequered pattern over a uniform grey field. They can discriminate between areas of dim light (3 and 0.25 lux). Responses to polarised and U-V light are undetermined, and their ability to respond to geomagnetic fields, which is linked to vision in other animals, is unresolved. H. aspersa and Limax are notable climbers, but geotropism is also useful when traversing rough ground or in vegetation. The optic tentacles show compensatory movements when a crawling snail is rotated. The optic tentacles are also sensitive to touch, and this thigmotaxis is used to avoid obstacles or to find a foothold. Moisture and temperature have major effects on activity levels of land pulmonates. Snails on a cold floor move towards a radiant heat source. However, they do not follow an air humidity gradient, and the sensory mechanism governing the response to moisture is unknown.
Caenogastropod evolution interpreted with aid of protoconch morphology Bandel, Klaus Hamburg University, Geological-Paleontological Institute and Museum, Bundesstrasse 55, 20146 Hamburg, Germany. Email bandel@geowiss.uni-hamburg.de 500 Million years of gastropod evolution have left their imprints in the organizations of living species and should be evaluated when a taxonomic classification is carried out. When dealing with fossil gastropods only characters of the shell can be evaluated. Classification based on the adult shell (teleoconch) dominated studies as for example those of Wenz (1938) or Knight et al. (1960). We now know that much convergence regarding the teleoconch shape occurred in the past and can still be noted in the living fauna. This has come to be known since the morphology of the protoconch has been added to the phylogenetic analysis. Seemingly well known fossil taxa such as the Subulitoidea, Loxonematoidea, Murchisonioidea, Euomphaloidea have been analysed accordingly and have been totally re-evaluated, and not one of them can remain within the Caenogastropoda or even their stem group. The sister taxon to the Caenogastropoda, according to anatomical and molecular data is represented by the Heterobranchia (=Heterstropha). Protoconch differences indicate that they have been on a separated evolutionary pathway latest by early Devonian time. To have a reliable base for this interpretation all surviving groups of either taxon need to have been evaluated regarding their protoconch morphology. This is the case. And last not least the fossil record has to be searched for fossils shells that have the protoconch preserved, which is more difficult the further back in time we search. Those gastropods with the protoconch placing them in the caenogastropod branch of gastropod evolution at Carboniferous and Permian time belong to groups that cannot be placed into any modern superfamily, and also their relation to modern orders is questionable. One exception may be the Pseudozygopleuridae, which can be interpreted to continue into the modern Ctenoglossa (=Ptenoglossa). The pseudozygopleurid larval shell has the characteristics of the zygopleurid protoconch as found in the Triassic, which can be traced through Jurassic and Cretaceous to the modern Cerithiopsioidea and Ianthinoidea with their potential branches of the Triphoroidea and Eulimoidea being added during the Cretaceous. Ctenoglossa, therefore, can be interpreted to represent a group that resulted from a caenogastropod revolution occurring probably at Late Devonian time. A strong diversification of the branch occurred in the Late Paleozoic. The other Caenogastropoda of the late Paleozoic were placed in the Orthonematoidea with three families, the Orthonemidae often convergent to Murchisoniidae of the Devonian. None of these families can be directly correlated with a group that is still in existence with an exception of the Permian Procyclophorida, which may continue in the Cyclophoroidea and have developed from Orthonemidae. But they have gone on land, and it is difficult to make certain that they are not just convergent land snails since the protoconch of all land and fresh water living gastropods is quite simplified and has no larval shell, but lecithotrophic development with crawling miniature adults hatching from the egg. The Anthracopupidae, for example, are convergent with modern pulmonate gastropods, while they represent a caenogastropod of the Procylophorida. While the Caenogastropoda of the Orthonemoidea and Pseudozygolpeuroidea continue their development after the Permian-Triassic faunal crisis and even diversify, the Procaenogastropoda of the Soleniscoidea and Peruneloidea characterized by their openly coiled protoconch disappear. The caenogastropod survivors of the Paleozoic taxa can still be recognized in the Triassic marine fauna, but a revolution producing many new groups had occurred after the Permo-Triassic extinction event. Stem group representatives of the Cerithioidea on one side (for example Ladinulidae and Popenellidae) and the Littorina-Rissoa relation (Littorinimorpha) (for example Prostyliferidae and Coelostylinidae) on the other side appeared. They can in part be traced through Mesozoic times and connected to modern superfamilies, better in case of the Cerithioidea than in the Littorinimorpha, probably because the last group is rather heterogeneous with the living species and unites quite a diverse lot. Among the new groups of Caenogastropoda that can be recognized in the late Triassic (mainly St. Cassian fauna) there are also the Purpurinidae, which may represent stem group species leading to groups that had their differentiation much later. One revolution followed an extinction event that is connected with the End of the Triassic. Now such groups as the Strombus-Apporhais relation (Strombimorpha) and the pelagic Heteropoda arose. Both groups still show similarities when their fully-grown larval stages are compared with each other. The larva of an Atlanta and of a Strombus has a six lobed velum, quite unusual otherwise among caenogastropod larvae. The new Jurassic groups rapidly spread around the world oceans due to the formation of the Tethys Ocean. While the Stromboidea branch is very obvious in the fossil record that of the Heteropoda is impressive only when its modern species are studied, while the fossil record is meagre. The taxonomic composition remained relatively stable on the higher taxonomic level until well into the Cretaceous. At about the same time when the Angiosperms evolved and revolutionized the flora of the continents, the Latrogastropoda evolved. Very rapidly the superfamilies of the Neomesogastropoda like Calyptraeoidea, Cypraeoidea, Naticoidea, Cassoidea, and Capuloidea appeared, and the Neogastropoda also are present, but they cannot be recognized with their nowadays often quite characteristic taxa right from start. Here the shell of planktotrophic larvae is usually an extremely useful tool for exact systematic determination of its carrier. But most of the diversification for example of such huge and species rich groups as that of the Turridae occurred after the Cretaceous-Tertiary faunal crisis. Neogastropod larval shells in the Cretaceous are rather uniform, while during the Paleogene many different shapes and ornaments appear which are characteristic for example in case of the Muricidae, the Coralliophilidae, the Nassariidae, and the Columbellidae. Not for all groups this has been well studied enough, but it will be a great help in getting a better understanding for the faunal crisis for example that at the Eocene-Oligocene transition. With the increasing knowledge of the shell of the planktotrophic larva of modern Caenogastropoda it became apparent that they are good tools for indicating their taxonomic place in the system. This information is lost when the early ontogeny of a species is without larval stage. Even though this handicap does not allow placing every species into its correct phylogenetic place almost all evolutionary units of marine caenogastropods have species with Plankton-feeding larvae. Viewing the paleontological record species with larval shells are at least as common as they are in the modern fauna. The protoconch has, therefore, become a very useful tool to trace caenogastropod evolution through real time.
Phylogenetic relationships of and speciation in Elysiidae (Sacoglossa, Opisthobranchia) Bass, A.L.* & Karl, S.A. Department of Biology, SCA 110, University of South Florida, 4202 E. Fowler Ave., Tampa, Florida 33620 USA. Email: abass@helios.acomp.usf.edu Members of the family Elysiidae (Sacoglossa, Opisthobranchia) are widely distributed, yet occupy narrow ecological niches. Current ecological information indicates that many species in the family are algal consumers. Members of the genus Elysia exhibit interesting adaptations to this lifestyle such as kleptoplasty and the manipulation of algal terpenoid compounds. Since the 1800’s a minimum of seven genera and 70-100 species have been described. Although there are a large number of described species, members of Elysiidae exhibit a conserved external morphology resulting in questions regarding species level designations and relationships, biogeography, and patterns of speciation within the group. Previously, analysis of allozyme variation in Florida populations indicated significant variability, but published studies are highly limited. Here we present preliminary findings of genetic variation in the mitochondrial genome using regions of the 16S RNA and cytochrome oxidase subunit I (COI) genes. Significant variation has been detected at both the species and population levels. The usefulness of these two gene regions for phylogeny reconstruction and population level analyses are examined and the preliminary findings of systematic and population level relationships are discussed. Finally we discuss the use of phylogenies in the detection of patterns of speciation and the relative roles of intrinsic versus extrinsic factors on speciation in the family Elysiidae.
The distribution of Tyrian Purple and influence of reproductive glands on secondary metabolism in the Muricidae. Benkendorff, K.*1, Westly, C.B.1, & Gallardo, C.S.2 1 School of Biological Sciences, Flinders University, GPO Box 2100 Adelaide 5001, Australia. Email: Kirsten.benkendorff@flinders.edu.au2 Institute of Zoology, Universidad Austral de Chile, Valdivia, Chile
Tyrian purple, also known as Royal purple, shellfish purple and Purple of the Ancients, is a well-known colourant that can be obtained from the hypobranchial glands of Muricids. More recently, we screened the egg masses from a range of Muricidae for Tyrian Purple and it’s precursors and found that these compounds were present in 70% of species examined. One species Trophon geversianus was found to contain bromoimidazoles instead of the brominated indoles (e.g. Tyrian Purple). Two further species (Trunculariopsis trunculus and Ceratostoma erinaceum) were found to contain both types of compounds, thus supporting the evolution of two different biosynthetic pathways for secondary metabolism within the Muricids. Chorus giganteus and Acanthina monodon were found to have the nonbrominated equivalent of Tyrian Purple but no brominated compounds in their egg masses, suggesting these species may have diverged from the ancestral Muricid prior to the evolution of a bromoperoxidase enzyme. However, further examination of the hypobranchial glands in the adults of these species revealed the presence of a purple pigment. Examination of the hypobranchial glands in a range of species revealed that the hypobranchial gland is typically fused to the reproductive (capsule and penial) glands and they appear to share a common membrane. In Dicathais orbita colour changes could be seen in both the capsule and penial glands, in addition to the hypobranchial gland, although the final colour was more red than purple in the reproductive glands. There was no clear evidence for this occurring in at least five other species, including two of which do produce Tyrian Purple in their egg masses. Interestingly, preliminary observations of detached sections of the hypobranchial glands in Dicathais orbita indicate a different suite of colour reactions occur, when compared to sections that are intact and attached to the penial glands. This suggests the reproductive glands are influencing the chemical conversions of the dye compounds by either controlling the redox conditions or through the presence of certain catalytic enzymes. Further studies on the secondary metabolism occurring within the hypobranchial glands and reproductive organs of Muricids are warranted, including confirmation of the chemistry behind the colours observed.
Principles of particle processing mechanisms in bivalves Beninger, Peter G. Laboratoire de Biologie Marine, Faculté des Sciences, Université de Nantes, Nantes 44322 Cédex France Despite the observed diversity of particle processing systems in Bivalves, unifying principles have emerged from new observational techniques and intensive study over the past fifteen years. The close-range mechanism of particle capture, while still in some dispute regarding physical interaction, involves compound latero-frontal cirri in the homorhabdic systems studied to date. Subsequent transport of all particles in this system is counter-current to the ventral gill extremity via muco-ciliary transport, in acidic (viscous) mucopolysaccharides. Transfer to the labial palps is via a mucus bridge, and ingestion volume regulation occurs on the labial palps, where pseudofeces are formed and rejected onto specialized pallial ciliated tracts, consisting of composite cilia and underlying acidic mucopolysaccharides, to the edge of the inhalent siphon. The two heterorhabdic systems (filibranch and pseudolamellibranch) show some similarities and some marked differences. The capture mechanism is not firmly understood, but since neither system possesses compound latero-frontal cirri (oyster lfc’s are composite), and since the principal filaments only move particles hydro-dynamically toward the dorsal (initial acceptance) tract, the mechanism is assumed to be hydro-dynamic, accompanied by relatively low-viscosity mucus. Material initially rejected on the gill is transported ventrally on the ordinary filament plicae, and in the filibranch system such material is voided via valve clapping without reaching the labial palps. In the pseudolamellibranch system, ventrally-directed material in acidic mucopolysaccharide mucus may be rejected directly onto the mantle rejection tracts in the event of gut satiation, or it may continue toward the labial palps for further decision. Pseudofeces from the labial palps are deposited on the mantle rejection tracts, and voided from the inhalent aperture. The sites and mechanisms of qualitative selection are the objects of renewed interest. In the heterorhabdic systems, both the gills and the labial palps are involved in this process. The filibranch principal filaments studied to date are large enough to allow entry of a very wide particle size range, so there is no size constraint on site of particle selection. In the pseudolamellibranch system, however, the principal filaments are too small to allow entry of particles > 70 : m; qualitative selection of larger diatoms etc. therefore takes place on the palps. Unambiguous identification of quality cues is difficult and ongoing; the outer casing and associated organic molecules of diatoms have recently been identified as such. Throughout the particle processing systems, common underlying mechanisms are apparent: the types of mucus used in transport on different types of surfaces, the types of cilia used for specific tasks, and the general architecture of the pallial organs in relation to the type of task performed (open vs. enclosed, raised vs level).
The invertebrate collections in the Field Museum of Natural History Bieler, Rüdiger*, Voight, Janet, Gerber, Jochen, Jones, Janeen, Pryzdia, Marty & Cramer, Ashley Department of Zoology (Invertebrates), Field Museum of Natural History, 1400 South Lake Shore Drive, Chicago, Illinois 60605-2496, U.S.A. Email: bieler@fieldmuseum.org After 110 years, the (non-insect) invertebrate collections of the Field Museum exceed 315,000 catalogued lots/series with continuing growth. We focus on the phylum Mollusca, currently represented by more than 300,000 lots. The research interests of past curators Fritz Haas (1938-1959) and Alan Solem (1956-1990) established the collection’s strengths in non-marine mollusks. Collection-building research of current curators Voight and Bieler concentrates on marine mollusks. These and other collection efforts also contribute to the non-molluscan collections, such as coelenterates, echinoderms and crustaceans. Numerous collections of individual collectors and orphan collections from other institutions are incorporated into Field Museum’s collections. With support from the U.S. National Science Foundation, all land snail holdings (about 140.000 series) have been computerized; our searchable database at <http://www.fmnh.org/research_collections> is currently the largest accessible "virtual" land snail collection anywhere. Ongoing data entry concentrates on active curatorial research projects, retrospective data capture of marine molluscan and non-molluscan holdings, with resultant data being gradually added to our website. Our poster highlights recent additions to the collections from ongoing field-research projects in the NE Pacific Ocean and the subtropical western Atlantic, and two important collection acquisitions, the Leslie Hubricht collection of eastern North American land snails and Alan Kohn’s collection of cone snails (Conidae).
A preliminary phylogeny of the Anodontinae (Bivalvia, Unionoida, Unionidae) Bogan, Arthur E.1*, Raley, Morgan E.1,2, Morrison, Cheryl L.3, Hoeh, Walter R.4, King, Tim L.3, & Levine, Jay F. 2 1. North Carolina State Museum of Natural Sciences, Research Laboratory, 4301 Reedy Creek Road, Raleigh, NC 27607 USA. email: arthur.bogan@ncmail.net 2. North Carolina State University, College of Veterinary Medicine, 4700 Hillsborough Street, Raleigh, NC 27606 USA 3. U.S. Geological Survey, Biological Resources Division, Leetown Science Center, Aquatic Ecology Branch, Kearneysville, WV 25430 USA 4. Dept. of Biological Sciences, Kent State University, Kent OH 44242 USA
The subfamily Anodontinae is Holarctic in distribution. However, the number of genera included in this subfamily varies with the author consulted. Haas recognized six subfamilies in the Unionidae and included eight genera in his subfamily Anodontinae and six genera in the subfamily Alasmidontinae. In contrast, Starobogatov placed the constituent species into two separate families, Unionidae and Lampsilidae, and distributed them among three subfamilies and three tribes in 41 genera. One common difference between the two proposed classifications is that Starobogatov elevated many of Haas’ subgenera to generic rank. Based on our analysis of DNA sequences from cytochrome c oxidase subunit I, we present a preliminary phylogeny containing 15 of the genera placed in the Anodontinae and Alasmidontinae by Haas and Starobogatov. Our phylogenetic analyses do not support either of the classifications discussed above. For example, the genera Lasmigona, Strophitus and Alasmidonta, as currently constructed, are not monophyletic groups.
An inordinate fondness for turrids
Bouchet, Philippe*1, Sysoev, Alexander2, & Lozouet, Pierre1 1. National Museum of Natural History, 55 rue Buffon, 75005 Paris, France. Email: pbouchet@mnhn.fr, lozouet@mnhn.fr 2. Zoological Museum of Moscow University, 6 B. Nikitskaya, Moscow, Russia. Email: sysoev@zmmu.msu.ru Turrids sing a hymn to specialisation, rarity, and evolutionary innovation. But turrid faunas are intimidating. Their systematics – at species, genus, and higher levels – is so daunting that they discourage monographic treatment. Despite this extensive morphological and ecological diversification, an ecologist, a paleontologist or a biochemist would have a difficult time determining from the existing literature the actual species richness of this most successful molluscan taxon. Twenty years of intensive sampling in the waters of New Caledonia, less than 1 million sq. km or 0.3% of the world ocean, has revealed a shocking 1,726 turrid species at depths from the intertidal to 3,700 m. As much as 30% are represented by singletons, which indicates that our sampling is far from saturated; the real number probably stands somewhere near 2,600 species. We estimate that 58-72% of the New Caledonia turrid fauna is undescribed. How do we best approach describing this magnitude of species diversity? The traditional taxonomists' tactic is typically to go family by family, genus by genus. Conventional wisdom is that, in the end, these piecemeal contributions add up to a complete treatment of local or regional faunas. We challenge an approach that, in 150 years of systematic malacology, has failed to depict the mind-boggling diversity of a single tropical molluscan fauna. As an alternative, we hold the view that labor specialization, rather than taxon specialization, is the key to producing monographs that reflect the real magnitude of molluscan diversity. We have launched a "turrid factory" assembly line, where the expertise of the taxonomist is restricted to the two decisions that cannot be delegated: which individuals / groups of individuals do I hypothesize represent a species? Which name do I use to designate that species? All the rest can be streamlined by contributors without taxon-specific knowledge.
Ecology and population trends on the New Caledonian Placostylus land snail populations - A PhD thesis Brescia, Fabrice Massey University (New Zealand) / IAC- Institut Agronomique néo-Calédonien (New Caledonia) Land snails of the genus Placostylus belong to the Bulimulidae Family and are found only in the Western Pacific in some islands of the Melanesian Plateau. The six different species found in New Caledonia are all endemic and are more or less endangered. Placostylus snails are found throughout New Caledonia, including the Loyalty Islands, and are favoured as food. However, the Isle of Pines, one of the many small coral islands surrounding the New Caledonian mainland, is the only location where the snails are found in sufficiently large amount in evergreen forest to be marketed and consumed. The harvesting of wild snails for consumption is a traditional economic activity which generates US $ 180 000 annually. The number of snails harvested has increased over the last few years and this has conducted to the dramatically decline of populations. Placostylus snails are also found on dry forests of New Caledonia. This kind of forest (also called sclerophyllous forest) is considered as the most endangered habitat of New Caledonia (only 1 % of the original surface remains). Snail populations are there highly threatened, some have already completely disappeared. This is mainly caused by habitat modifications (feral ungulates) and impacts of introduced predators (rodents, feral pigs). This PhD will contribute to the conservation and the sustainable use of New Caledonian Placostylus snails. This research proposal constitutes also a prime study model with regards to the evolution of exploited species with small populations that are subjected to miscellaneous pressure factors. More generally, the research will also contribute to the development of tools for use in the field of Conservation and Restoration Biology and take biological and socio-economic considerations into account.
New Caledonian Placostylus land snails reared in captivity: impact on their conservation Brescia, Fabrice IAC- Institut Agronomique néo-Calédonien (New Caledonia) Land snails of the genus Placostylus (Bulimulidae), show a very restricted distribution area (Western Pacific).The species found in New Caledonia are all endemic and are more or less endangered. In New Caledonia, Placostylus snails are favoured as food, collected in forest (Isle of Pines mainly), marketed and consumed. Furthermore, as an important part of Melanesian culture and traditions, the snails are used for various purposes such as food and jewellery as well as for their medicinal properties. The number of snails harvested on the Isle of Pines has increased over the last few years and reached a maximum of 48 tons (about 700,000 snails) in 1993. A recent survey indicated an 40 % decrease in the number of wild snails between 1993 and 2000, a situation which is mainly due to over-exploitation. Local authorities therefore imposed measures designed to limit the amount of snails harvested by forbidding gathering during the reproductive season. In parallel to these control measures, the Institut Agronomique néo-Calédonien (I.A.C.) is exploring conservation strategies such as off-site preservation as well as developing farming methods. The management of the latter would allow exploitation of this natural resource to continue, a matter which is of great concern to the local people, as well as the preservation of wild snail population as part of the new Caledonian biodiversity. In addition, successful farming would enable the production and restocking of small populations of P. fibratus in areas where they are almost extinct, a situation often caused by habitat modifications and impacts of predators such as carnivorous snails, feral pigs, rats, etc… The species found in New Zealand are currently endangered. Authorities are in the process of trying to reduce the number of extinctions by establishing new snail populations in areas they once occupied. Research is also being carried out into captive rearing techniques while in captivity. The poster presents the captive rearing technique for Placostylus snails, and discuss about conservation implications.
"Impoverished and less-perfected"? - A molecular phylogeny and zoological geography of Australian freshwater Thiaridae Brinkmann, Nora*, von Rintelen, Thomas & Glaubrecht, Matthias Museum of Natural History, Humboldt University, Institute of Systematic Zoology, Invalidenstrasse 43, D-10115 Berlin, Germany. Email: matthias.glaubrecht@rz.hu-berlin.de
The latter are characterised by several unique morphological features (e.g. shell, operculum, radula, mantle, reproductive anatomy). In addition, a molecular phylogeny based on partical 16S rDNA sequence data suggest a new systematization of these viviparous gastropods. Currently used taxonomy implies that not only species but genera (Ripalania and Sermylasma, both of Iredale, 1943) occur in Australia exclusively. So far our molecular phylogeny suggests that only two lineages are in fact endemic to this continent, viz. Plotiopsis (with "Thiara" balonnensis as type species) and a yet unresolved (and unnamed) complex of Melanoides/Stenomelania species, but not Iredale’s two taxa. Instead, all other Australian thiarids cluster with or within non-Australian taxa and are hypothesized to have colonized rivers here via veligers as dispersal stages.
Dendrodoris arborescens (Collingwood, 1881) (Mollusca: Nudibranchia): larval characteristics reveal a masked porostome Brodie, Gilianne D. 1 & Calado, Gonçalo 2* 1. School of Marine Biology & Aquaculture, James Cook University, Townsville, Queensland 4811, Australia. Email: gilianne.brodie@jcu.edu.au 2. Departamento de Ciências Naturais e Biológicas. Universidade Lusófona de Humanidades e Tecnologias. Av. do Campo Grande, 376 1749-024 Lisbon, PORTUGAL and Centro de Modelação Ecológica IMAR. FCT/UNL Quinta da Torre 2825-114 Monte da Caparica, Portugal. Email: bagoncas@mail.telepac.pt
The nudibranch Dendrodoris arborescens (Collingwood, 1881) has hitherto been (1) mistaken for the sympatric species D. nigra (Stimpson, 1855) that is similar in appearance, or (2) considered as a colour form of D. fumata (Rüppell & Leuckart, 1828). Our investigations of larval biology and colour pattern however, clearly show that D. arborescens is a valid species with its own set of unique characteristics. This result increases the number of Dendrodoris species known from the Australian coastline to thirteen and highlights the useful nature of larval features to species identification.
Biomineralization in the radula teeth of chitons and its application to systematics in the Polyplacophora Brooker, Lesley R.1*, Lee, Alasdair P.2, Macey, David J.3, Webb, John 3, & van Bronswijk, Wilhelm 2 1 Faculty of Science, University of the Sunshine Coast, Maroochydore, Qld., 4558, Australia. Email: lbrooker@usc.edu.au2 Department of Applied Chemistry, Curtin University, Bentley, WA, Australia.3 Division of Science and Engineering, Murdoch University, Murdoch, WA 6150, Australia.The major lateral radular teeth of chitons (Mollusca: Polyplacophora) are composite materials, incorporating a variety of biominerals within an organic scaffold. Numerous studies, conducted over the past 30 years, have proposed that chiton teeth are comprised of a variety of iron and calcium minerals, such as the iron oxides magnetite, lepidocrocite, goethite, maghemite and limonite, along with calcium phosphates, such as fluorapatite, francolite and dahllite, or amorphous hydrous ferrous phosphates. While magnetite is ubiquitous to the major lateral teeth of all Polyplacophorans whose radulae have been described to date, its distribution in these teeth is not constant. In some species it only covers the posterior (cutting) surface of the tooth, barely extending over the distal tip, while in others it wraps around the whole cusp. Unlike magnetite, the other biominerals are not common to all Polyplacophora, and the variety of mineralization strategies employed by chitons could well reflect phylogenetic affinities, providing a basis for the utilization of biomineralization as a systematic tool in chitons. A current understanding of the biomineralization processes in the major lateral radular teeth of chitons will be presented, along with an appraisal of the different biomineralization strategies employed by chitons. The systematic implications will then be discussed.
Urbanisation of coastal areas: threats to marine molluscs and conservation needs Bulleri, F. Dipartimento di Biologia Evoluzionistica Sperimentale, Centro Interdipartimentale per la Ricerca nelle Scienze Ambientali, Università di Bologna, Via S. Alberto 163, I-48100 Ravenna, Italy. Email: fbulleri@ambra.unibo.it Marine habitats are seriously threatened by fast rates of urbanisation. Molluscs, being one of the most diverse groups of marine invertebrates and playing crucial roles in the functioning of coastal habitats provide a unique opportunity to test hypotheses about the effects of urbanisation on shallow water assemblages. Focusing on marine molluscs, I will provide a critical overview of the major human impacts in coastal and estuarine areas. In particular, I will address the issue of transformation of coastal landscapes in urban areas, showing their potential to cause changes at different levels of organization and at a variety of spatial and temporal scales. Specific examples will illustrate the response of molluscan assemblages and populations, in terms of genetic variability, behavior and patterns of distribution and abundance, to loss and fragmentation of natural habitats caused by the introduction of artificial structures, such as seawalls, breakwaters, groynes, pier pilings and floating pontoons. The implications for the persistence of populations of molluscs and for key ecological processes will be discussed according to natural history traits, functional role and natural patterns of abundance and distribution of species. Examples of alternative managerial options will illustrate how, improvements in our scientific understandings of the biology and ecology of marine molluscs, are necessary to enhance our ability in planning strategies for conservation of this group in a changing world. Finally, future research priorities will be outlined, stressing the need for experimentally sounded approaches, enabling predictions of the changes which will occur in assemblages of molluscs. Due to the interactive and compounded effects of multiple sources of disturbance taking place in urban areas, future studies will have to incorporate experimental tests of hypotheses aimed at evaluating cumulative effects against the natural background of variability.
Radiation and ecology of "solar-powered" Nudibranchia Burghardt, Ingo* & Wägele, Heike Ruhr-University Bochum, Spezielle Zoologie, D-44780 Bochum, Germany. Email: ingo.burghardt@rub.de; heike.waegele@rub.de
A symbiosis with unicellular dinoflagellates of the genus Symbiodinium is known from different marine invertebrates, including taxa within the Nudibranchia, especially the Aeolidoidea. The source of these zooxanthellae in aeolids is mainly octocorals, on which the nudibranchs feed. In taxa of the Dendronotoidea the source mostly is not exactly known. Symbiodinium is housed inside the cells of the nudibranchs digestive gland. This is affirmed for several species by histological means. But a mutualistic symbiosis with affirmation of exchange of metabolites is tested only in a few species. The aeolid genus Phyllodesmium shows, compared to other aeolid taxa, a high number of species (approx. 27 species). For several species of this genus the storage of zooxanthellae is well documented, for others no data are available yet. It is assumed that the relationship of the slugs with zooxanthellae was a key-innovation for the radiation of this taxon, which allowed foraging on octocorals of small population size. Photosynthesis of Symbiodinium within the slugs is measured in long-term experiments with a diving-PAM and histology and ultrastructural investigations clarify special adaptations of the aeolid species involved. Molecular markers (SSU rDNA, ITS) are used to investigate the phylogeny of the taxon Phyllodesmium and its relationship within the Aeolidoidea and other zooxanthellae-housing taxa. Additionally, reproductive strategies, distribution patterns and biogeography, as well as physiological and phylogenetic analyses of the involved Symbiodinium are investigated for better understanding of the evolution of zooxanthellae housing taxa.
Reproduction in two nudibranchs of the genus Doriopsilla Bergh, 1880 (Gastropoda, Opisthobranchia) with distinctly different developmental strategies Calado, G.* 1,2 & Soares, C.2 1 - Departamento de Ciências Naturais e Biológicas, Universidade Lusófona de Humanidades e Tecnologias, Av. do Campo Grande, 376, 1749-024 Lisbon, Portugal. Email: bagoncas@mail.telepac.pt2 - Centro de Modelação Ecológica IMAR. FCT/UNL; Quinta da Torre, 2825-114 Monte da Caparica, Portugal
Doriopsilla areolata and Doriopsilla pelseneeri are two common dorid nudibranch molluscs inhabiting the south-western coasts of Europe (Atlantic and Mediterranean). Doriopsilla areolata has planktotrophic larvae whereas, D. pelseneeri is a metamorphic direct developer. The reproductive effort of both species was studied during the peak reproductive season (March-June 2003). In both species, the number of eggs per spawn mass, the average volume per egg, and the percentage of body weight allocated to reproduction were compared among individuals of different sizes and from different locations. Egg volume was found to be a constant feature of each species, whereas the number of eggs per spawn is highly correlated with the size of the egg-laying parent. Although these two sympatric species have contrary developmental strategies, the amount of energy allocated to the production of each spawn mass lies within a similar range.
Alan Solem’s work on the diversity of Australasian land snails: an unfinished project of global significance Cameron, Robert A.D.*1, Pokryszko, Beata M.2 & Wells, Fred E.3 1.Department of Animal and Plant Sciences, University of Sheffield, Sheffield S10 2TN, UK, and Department of Zoology, The Natural History Museum, London SW7 5BD, UK. Email: r.cameron@sheffield.ac.uk 2. Museum of Natural History, Wroc ław University, Sienkiewicza 21, 50-335 Wrocław, Poland3. Western Australian Museum, 1 Francis Street, Perth WA 6000, Australia Alan Solem’s systematic work focused on Pacific island Endodontoidea and on Australian Camaenidae. His many papers on these taxa deal with 647 species (329 new) and 136 genera. His descriptions and identification criteria are detailed and clear. Though not a formal cladist, his interpretation of characters shows that his approach was intuitively cladistic, and his phylogenies are likely to survive formal analysis. His comprehensive revisions, and his cataloguing of whole faunas enabled him to analyse patterns of distribution, and to relate them to evolutionary, biogeographic and ecological theory. For the Pacific Islands, he exposed the limitations of the equilibrium theory of MacArthur and Wilson, drawing attention to its neglect of in situ speciation. In Australia, he identified many cases of remarkable allopatric distributions amongst camaenid genera and species, many of which have minute geographical ranges. Because he studied the whole fauna, and achieved remarkable geographical coverage, he could contrast these patterns with those seen in other families, and in the much richer faunas he studied in New Zealand, where many congeners coexist. He used his experience as a basis for a global review of land snail diversity. Some of the questions and ideas he raised are discussed here and elsewhere in the symposium. At the time of his death, Solem was working on the description of more material (8-10 genera and c. 100 species), and had started to explore the evolutionary events underlying these contrasts. Both his described and undescribed materials are available in WAM and FMNH, and offer the opportunity for cladistic and molecular analysis, answering questions of theoretical and conservation concern. His work has already informed conservation planning in Western Australia. Snail faunas are good general indicators of conservation value, and the completion of his work will further aid conservation planning.
Development of the pallial cavity particle processing structures in postlarvae of the oyster Crassostrea gigas Cannuel, R. and Beninger, Peter G.* Laboratoire de Biologie Marine, Faculté des Sciences, Université de Nantes, 44000 Nantes France. Email : Peter.Beninger@isomer.univ-nantes.fr In order to better understand the impact of organogenesis on particle processing in the oyster Crassostrea gigas, larval and post-larval animals were observed using scanning electron microscopy, up to 112 days post-fertilization (corresponding size range 0.2 – 10.1 mm). The first gill filaments appeared at a size of approx. 0.34 mm, by elongation of the ventral extremity of the internal demibranch anlagen. The two dorsal extremities of each gill anlage remained fused to the mantle, while the interior of each ‘V’ appeared. This contrasts starkly with the process in the Pectinidae, the other major group of heterorhabdic bivalves. The external demibranchs began to appear, by the same process, at a postlarval size of approx. 2.7 mm (36 days). Latero-frontal cilia appeared at a size of approx. 2.5 mm, and these were never fused. The differentiation of the three ordinary filament frontal ciliary tracts also appeared at a size of approx. 2.5 mm. The principal filaments formed at a size of approx. 7.5 mm (91 days), via complete fusion between the abfrontal lateral margins of three adjacent ordinary filaments, accompanied by a progressive frontalward rotation of the outer members of the triplets. Plicae were definitely recognizable at 10 mm Labial palp anlagen appeared at a size of approx. 0.4 mm, and appeared functionally competent at approx. 2.7 mm. The vestigial veliger mantle rejection tract was progressively replaced by the characteristic radiating oyster mantle rejection tracts at a size of approx. 2.8 mm. On a functional level, these data indicate that while postlarval C. gigas undergo less radical changes in gill structure than the pectinids studied to date, three relatively discrete types of gill structure appear in succession: a homorhabdic ‘V’ – shaped left and right gill, a homorhabdic ‘W’ - shaped left and right gill, and a plicated, heterorhabdic gill. The change from the homorhabdic to the heterorhabdic condition, at a size of approx. 7.5 – 10 mm, involves a major change in gill function, and may constitute a critical stage in the development and survival of juvenile oysters. The complex adult particle processing capability does not seem to be in place before a size of 10 mm (approx. 112 days), at the earliest.
The resilience of Hydrobia ulvae populations to anthropogenic and natural disturbances Cardoso, P.G.1*, Brandão, A.1, Pardal, M.A.1, Raffaelli, D.2 & Marques, J.C.1 1 IMAR – Institute of Marine Research, Department of Zoology, University of Coimbra, 3004-517 Coimbra, Portugal. Email: gcardoso@ci.uc.pt2 Environment Department, University of York, Heslington, York, YO10 5DD, U.K.In the Mondego estuary (Portugal), several mitigation measures (nutrient loading reduction, seagrass beds protection and freshwater circulation improvement) were implemented in 1998 in order to promote the recovery of the seagrass beds and the entire surrounding environment following a long period of eutrophication. In the present study we evaluate the success of this restoration project by comparing the dynamics of a common estuarine invertebrate, Hydrobia ulvae, before and after the implementation of the management measures. During the period in which environmental quality declined, H. ulvae abundance, biomass and growth production declined, associated with the almost total disappearance of Z. noltii. However, after the implementation of management measures, dissolved nutrients and green macroalgal blooms were much reduced, and seagrass beds started to recover. The H. ulvae population also responded positively, becoming more structured, and with higher abundance and biomass. Major flood events demonstrated that the resilience of the H. ulvae population may have been lowered by presence of the original stressor (eutrophication). The population structure of H. ulvae in the most stressed site continued to be dominated by small individuals despite improvements in water quality, probably due to the possibly irreversible disappearance of seagrass plants at this site. Estuarine restoration programmes need to recognise the importance of understanding the resilience of populations and the interactions of multiple stressors.
Minihams’ of Guam, a group of longtailed Haminoeidae (Opisthobranchia: Cephalaspidea) Carlson, Clayton H.* and Hoff, Patty Jo University of Guam. Email: ccarlson@kuentos.guam.net or pjohoff@uog9.uog.edu Six previously undescribed haminoeid Cephalaspidea from Guam are discussed. They are characterized by their small size; thin, extended tail; modified headshield; eyes on the surface of the head; apparent lack of Hancock’s organs; thin, transparent shell; radular formula of 2.1.2, and gizzard plates with single rows of rods. Photographs of the living animal, of the headshield, the shell and gizzard plates are presented for each species. Drawings of the headshield are compared with the photographs. SEMS or photographs are used to show the radulae. For some species drawings are given for the male and female genital systems; and photographs of the egg masses. Brief discussion is given of the placement of these species within the Haminoeidae, Hancock’s organs, a possible intermediate species and radular asymmetry.
The phylogeny of Thordisa (Nudibranchia: Discodorididae) with descriptions of five new species Chan, Jamie M.* & Gosliner, Terrence M. Department of Invertebrate Zoology, California Academy of Sciences, 875 Howard Street, San Francisco, California 94103 USA. Email: jchan@calacademy.org The dorid nudibranch Thordisa Bergh, 1877, consists of 36 described species, of which 25 are currently recognized as valid. The genus has never been monographed. All are relatively uncommon and their morphology poorly described with the exception of T. bimaculata Lance, 1966, T. aculeata Ortea & Valdés, 1995, T. rubescens Behrens & Henderson, 1981, T. filix Pruvot-Fol, 1951, and T. azmanii Cervera & Garcia-Gomez,1989. Five new species are described here. All specimens were found in intertidal or subtidal waters. Four were found in the Indo-Pacific and one from the Eastern Pacific. A preliminary analysis of the phylogeny of Thordisa is presented here for the first time, using three outgroups Asteronotus, Halgerda and Hoplodoris. The systematics and phylogeny of Thordisa from the tropical Indo-Pacific and Eastern Pacific are revised. Morphological and anatomical data from Thordisa species were used to construct a preliminary phylogeny. The phylogenetic analysis demonstrates the monophyly of Thordisa and its relationship to the outgroups Asteronotus, Halgerda and Hoplodoris.
Molluscan habitat produced by intertidal seawalls in Sydney Harbour Chapman, M. Gee Centre for Research on Ecological Impacts of Coastal Cities, Marine Ecology Laboratories A11, University of Sydney, NSW 2006, Australia. Email: gee@bio.usyd.edu.au Many of the world’s big cities are on the coast or in estuaries. Although the ecological effects of urbanization have been widely studied, most research has concentrated on terrestrial habitats. Effects of urban change on marine habitats are largely ignored, even though urbanization obviously causes very large changes to natural shorelines. Urbanization not only degrades and destroys habitats, but also adds many new and different types of habitat to the environment – the most common of which are seawalls. Although many intertidal and subtidal species live on them, seawalls do not appear to provide appropriate habitats for all species. Seawalls also degrade through time, producing intertidal piles of rubble, which superficially resemble intertidal boulder-fields. This talk examines assemblages of molluscs on seawalls, natural rocky shores, in natural boulder-fields and in those created by collapsed seawalls to identify the changes that urbanization can bring to intertidal molluscs living in urbanized environments.
Taxonomy and biology of Siphonaria (Mollusca: Pulmonata) in Singapore
Chim, Chee Kong* & Tan, Koh Siang Tropical Marine Science Institute, 14 Kent Ridge Road, Singapore 119223. Emails: (Chim) tmscck@nus.edu.sg, (Tan) tmstanks@nus.edu.sg Pulmonate limpets are common on rocky shores in Singapore, and are often the dominant herbivore present on seawalls. However, previous species descriptions based on the shell have caused much confusion regarding their identities as the shell is variable. The use of characters other than those based on the shell, has helped considerably to distinguish species. Differences in the genitalia, radula, egg mass, veliger shell and mode of larval development all support the hypothesis that there are three species present in Singapore. Siphonaria guamensis Quoy & Gaimard, S. javanica (Lamarck) and S. atra Quoy & Gaimard are widespread in the Indo-Pacific province. Siphonaria guamensis was found to be the most common pulmonate limpet on Singapore. The life history of this species was examined in detail at a seawall in Singapore. Shell size and egg mass output were monitored every two weeks for one year. The results show that juvenile S. guamensis recruited between the months of August 2003 and January 2004. They increased in shell size at about 1 mm per month and a sustained spawning season lasting more than six months was apparent. However, spawning was not apparent during the earlier months of the year, and little recruitment of juveniles was seen between the months of January and July 2004.
The radula of juvenile abalone, Haliotis asinina, Linnaeus, 1758 from Thailand Chitramvong, Y.P.* & Kaewkamthong, V. Biology Department, Faculty of Science, Mahidol University, Rama 6 Road, Rajathewee 10400, Thailand. Email: scyct@mahidol.ac.th The radula of Haliotis asinina was very long and ribbon like in structure. The average lengths of the radula at the age of 1- to 12- month- old were from 0.77 + 0.26 to 13 + 1 mm, respectively. They were gradually increased at the age of 5 to 11 months. However, the average lengths of radula were slightly increased at the age of 1 to 4 months and 11 to 12 months. The average number of transverse rows from 1- to 12- month- old ranged from 25 to 64, respectively. There were three types of teeth in each transverse row: the central; lateral; and marginal. The radula formula of 1- month- old abalone was ¥ : 4 : 1 : 4 : ¥ while that of 2- to 12- months was ¥ : 5 : 1 : 5 : ¥ . The central tooth was a large unicuspid. Its base was slightly curved inwards at the age of 1 month and curved outwards at the age of 2 to 12 months. The first lateral tooth was unicuspid. It was long and slender at the age of 1 month and wide and broad at the age of 2 to 12 months. The second lateral tooth had long and slender base and multicuspid with a larger center cusp and 1 to 2 smaller serrations on each side at the age of 1. At the age of 2 to 12 months, they were unicuspid and their bases were stalk – like and wing – shaped. The third to fifth lateral teeth were multicuspid with a large spadeshaped center cusp and 1 to 3 smaller serrations on each side at the age of 1 to 2 months and they become unicuspid at the age of 3 to 12 months. Besides, the fifth lateral tooth was not found in the 1- month- old abalone. The marginal tooth had long stalk and was multicuspid with several smaller serrations on both sides of the central cusps. The number of smaller serrations of the sub-marginal and middle marginal teeth were the highest at the age of 1 month. However, those of outer marginal tooth were rather similar at all juvenile abalone ages.
Optimal conditions for artificial fertilization, embryonic development, and larval growth of the purple clam Saxidomus purpuratus in the southern coast of Korea Choi, Jin-Woo*, Lee, Chang-Hoon & Ryu, Tae-Kwon South Sea Institute, KORDI, Geoje 656-830, Republic of Korea. Email: jwchoi@kordi.re.kr Laboratory experiments were conducted to obtain the basic information on culture conditions for the larvae of the purple clam Saxidomus purpuratus, one of important clam resources in the southern coast of Korea. This study was focused on (1) the success in fertilization and development from artificial fertilization according to the different months of a year, (2) the viability of sperms after exposure to seawater, (3) and the effects of temperature, salinity, and food organism on the survival and growth of larvae. High fertilization rate of gametes obtained from dissecting gonads was obtained at all months if clams were kept in room temperature. But high successful development occurred only during May-July. Developmental success seemed to be related to the egg quality at the fertilization time. Developmental times for 2-cell, 4-cell, 8-cell, blastula, trochophore, and veliger at 20°C were 1.5, 2, 4, 18, 24, and 32 hours, respectively. Sperms could survive for up to 8 hours; however, actively swimming sperms could be found within 1 hour after exposure to seawater. Thus sperm should be used for fertilization as soon as possible when they were exposed to seawater. At high temperature (35°C), all the larvae died within 48 hours. Larval survival decreased when salinity was either lower than 20 psu or higher than 40 psu, and it was nearly 0% when salinity was 10 psu. Optimal temperature and salinity ranges of larvae of S. purpuratus were 20-25°C and 20-40 psu, respectively. Larvae grew from 111.5 to 235.3 μm during 21 days. Larvae grew faster when mixed algal diets were supplied than single kind of algal diets: the fastest growth was observed when larvae were fed on the mixture of Isochrysis galbana and Nannochloris oculata.
Distribution and abundance of sea hares in tropical intertidal habitats in relation to environmental factors Clarke, Cathryn L.* and Rocky de Nys James Cook University, Townsville, Queensland, 4811, Australia. Email: ClarkeCa@pac.dfo-mpo.gc.ca Sea hares are considered highly unpredictable in their distribution. Quadrat and transect sampling was conducted in four habitats surrounding Townsville and Magnetic Island, Queensland, Australia. A total of five species of sea hare were identified during the course of sampling: Aplysia dactylomela, A. extraordinaria, Petalifera petalifera, Stylocheilus striatus, and Bursatella leachii. Two species demonstrated direct relationships with their preferred host plants. The spatial and temporal distribution of Petalifera petalifera was related to the distribution of its host plant, Padina tenuis. This monophagous sea hare-host relationship has not been previously documented. The distribution of A. dactylomela was correlated with a number of host plants; however the best relationship was obtained when compared with the red algae (Rhodophyta) as a group. All sea hares were restricted in their temporal distribution, only occurring in winter months (May-August 2003). This distribution will be discussed with regard to habitat and environmental cues.
The interaction between radula morphology and feeding type in opisthobranch molluscs Clarke, Cathryn L.*1, Klussmann-Kolb A.2, & Brodie, Gilianne D.1 1. James Cook University, Townsville, Queensland 4811, Australia. Email: ClarkeCa@pac.dfo-mpo.gc.ca 2. Zoologisches Institut der J.W. Goethe Universität, 60054 Frankfurt am Main, Germany The molluscan feeding apparatus interacts directly with the host plant on a fine scale and therefore may have a certain degree of influence over the feeding preferences exhibited. In contrast to other taxa, the morphology of sea hare radulae have never been investigated in the context of defining feeding types and exploring their relation to feeding preferences. Scanning electron microscopy was used to examine the morphology of the radula teeth of Australian sea hares species and a theoretical framework developed. This talk details the four radula functional types discovered: Simple, Bilobed, Pinnate, and Denticulate. These four radula types have a direct relationship with the preferred prey items of the sea hare species assigned to each type. Sea hare radulae also exhibited a continuum of simplicity-complexity that is reflected in the feeding preferences determined experimentally by other workers. The links between radula type, feeding specificity, and body size are discussed.
Reproduction of Adelomelon brasiliana, a commercial volutid from Argentina (Caenogastropoda) Cledón, Maximiliano Alfred Wegener Institut for Polar and Marine Research, Columbusstr., 27568 Bremerhaven, Germany
Adelomelon brasiliana (Caenogastropoda; Volutidae) inhabits shallow waters between 5 and 20 metres depth on sandy bottoms of the south-western Atlantic Ocean. The commercial importance of A. brasiliana emerged during the 80’s and early 90’s. In Argentina A. brasiliana is a very abundant species being captured by bottom trawling near the coast. The reproductive season of a studied population near Mar del Plata (38°20’S) extends from September to April (austral spring and summer), showing synchronization with water temperature (oocytes growth with low temperatures and spawn with high temperatures). Yolk content of the oocytes increases until they reach 200 mm in diameter before spawning. In autumn, a resting phase begins, in which no new oocytes develop and the non-spawned ones undergo reabsorption. Gonadic development begins during the early winter and new previtellogenic oocytes can be observed under the epitelium. The shell size at sexual maturity is about 100 mm, while the 50% of the population is mature approximately at 115 mm shell length, when they are 8 years old. The maximum age registered was 20 years. TBT pollution in the studied area is very low and does not affect the reproductive cycle of the population. TBT in sediment ranges from 1,4 ng*g-1 in the areas near the port to 0,2 ng*g-1 in the less affected areas. A one year TBT and imposex monitoring A. brasiliana in the most polluted area showed high constant TBT and DBT concentrations in hepatopancreas 90 and 38 ng*g-1 wet mass respectively, while in muscle the concentrations of TBT were around 35 ng*g-1 and DBT decreased from 17 to 9 ng*g-1 its purification capacity. % of imposex decreased from 100 to 60.
Endemism of Crepidula in SW Atlantic Cledón, Maximiliano Alfred Wegener Institut for Polar and Marine Research, Columbusstr., 27568 Bremerhaven, Germany
A few years ago, Crepidula species from Argentina were to be composed of cosmopolitan species or from magellanic fauna. The description of some endemic species based mainly on reproductive traits and the finding of some of the magellanic province species, give us a new panorama contributing to clarify the taxonomic status of the complex. C. argentina differs from C. protea because of in the higher number of eggs per capsule and the smaller diameter of the eggs. C. cachimilla n. sp. (in press) differs from C. onyx manly in its reproductive mode lacking of nurse eggs. C. cf aculeata in Argentina might be also a different species than the one of Florida and also different from the one in Venezuela. The Argentinean population presents nurse eggs a significant higher number of eggs per capsule and smaller uncleaved egg diameter compared with the Venezuelan population. The presence of C. dilatata in Argentina, but not C. fecunda, restricted to the Pacific Ocean is also paradigma on this scheme. This studies are changing not only the geographic range of single species but also the evolution history map and radiation of the group in the southwestern Atlantic.
A novel molecular approach to the study of a mussel hybrid zone on the west coast of Ireland Coghlan, Brian & Gosling, Elizabeth* Molecular Ecology Research Group, Galway-Mayo Institute of Technology, School of Science, Galway, Ireland. Email: elizabeth.gosling@gmit.ie The shores of the Nortwestern Atlantic have two indigenous mussel species, the Mediterranean mussel Mytilus galloprovincialis and the Blue mussel, Mytilus edulis. These two species, once isolated by the last ice age, are now occurring sympatrically along 1,500 miles of the Northwestern Atlantic coast. The two species interbreed and hybridise producing a mosaic hybrid zone over much of this range. On exposed west of Ireland rocky shores M. galloprovincialis occurs predominantly high in the intertidal zone, while M. edulis is more abundant at lower tidal levels. This distribution has remained unexplained. However, it has been hypothesised that factors such as resistance to desiccation, wave exposure, refuge from predators and primary or secondary selective settlement act singularly or accumulatively to explain the distribution of M. galloprovincialis in the high intertidal zone. Until the late 1990s there was no single morphological or genetic diagnostic marker that could unequivocally discriminate between these two species. Now, however, a new nuclear DNA marker has been developed which is not just totally diagnostic but also identifies hybrid individuals. Larvae settling from the plankton onto pads placed at two shore levels from two exposed shores in Galway Bay have been analysed using this marker. The results indicate that there is no difference in the proportions of M. edulis, M. galloprovincialis or hybrids settling at either tidal height on either shore. This result suggests that there is blanket, rather than preferential, settlement of primary settlers onto exposed shores. The pattern observed in adults of the two species, with respect to tidal height, may be due to redistribution or selective mortality of spat after initial settlement.
Molecular phylogenetics of the Caenogastropoda Colgan, D.J.*, Ponder, W.F., Beacham, E., and Macaranas, J.M. The Australian Museum, 6 College St. Sydney, NSW 2010, Australia. Email: donc@austmus.gov.au
Neither the membership nor the internal relationships of the Caenogastropoda, the largest and most diverse group of living gastropods, have been convincingly demonstrated. This may be due to the group’s great variety of habitat and morphology, the rapidity of its radiation at least among the Hypsogastropoda or a prevalence of honplasous convergence. It may also be due to a relative lack of anatomical or DNA sequence data. There has been no comprehensive cladistic analysis of the group despite encouraging progress resulting from studies of digestive system morphology and partial 18S rDNA sequences. In this project we have collected data from a variety of nuclear and mitochondrial genes from a wide diversity of Caenogastropoda in an effort to discern the major lineages within the subclass. The DNA segments studied were five segments of the 28S ribosomal DNA, the 5’ end of the 18S rDNA, part of domain III of the 12S rDNA, Histone H3, U2 small nuclear RNA and subunit I of cytochrome c oxidase. Seven outgroup species (including four heterostraphans) were included, together with three "Architaenioglossa", 2 "Neotaenioglossa", Campanilidae and 23 Hypsogastropoda. Data were analysed using maximum parsimony, maximum likelihood and Bayesian approaches. Among the major results were (1) Although "Architeanioglossa" and "Neotaenioglossa" were not monophyletic, these and Campanilidae were generally included in a recognisable, monophyletic group of non-hypsogastropods. (2) Few robustly supported clades were recovered within Hypsogastropoda. In particular (3) Neogastropoda was not monophyletic in any analysis. (4) Heteropoda was the sister group to Littorinidae. (5) Monophyly of Caenogastropoda was challenged by the enigmatic placement of Eatoniellidae. This varied between genes and between analyses. The family was often shown in an intermediate position between Caenogastropoda and Heterostropha. A second species of the family was sequenced for 18S rDNA and supported the placement for this gene.
Fundamental niches as driving factors in marine biodiversity: a case study with bivalves and temperature Compton, Tanya University of Groningen, Royal Netherlands Institute for Sea Research, Department of Conservation and Land Management. Email: compton@nioz.nl The tropical mudflat Roebuck Bay (North West Australia) has 65 bivalve species compared to 17 bivalve species in the Wadden Sea, a temperate European mudflat system. Biodiversity differences between tropical and temperate locations such as these are well-known. However, there is limited information on how tropical and temperate locations differ ecologically. By measuring the full range of tolerances that organisms can withstand (fundamental niche) it might be expected that differences in species packing between tropical and temperate locations will become clear. One such fundamental niche is the range of temperatures at which bivalves can survive. Wide temperature ranges in temperate regions led to the expectation that temperate organisms would have a broader fundamental niche relative to tropical. Our temperature tolerance measurements show that temperate bivalve species tolerate a slightly greater temperature range than tropical bivalve species. Both upper and lower limits are shifted to lower temperatures in temperate species; with the lower temperatures showing the greatest shift. Seasonal differences were insignificant relative to differences between species in the two locations. In conclusion, the slightly broader and shifted range in Wadden Sea species could suggest an adaptation to the wide temperature range in this location. This could also imply that generalization to temperature decreases the number of niches and subsequently biodiversity.
Identifying pearl oyster spawning patterns from spat surveys and dispersion modelling on Australia's North West Shelf Condie, Scott A.1, Mansbridge, Jim V.1, & Hart, Anthony M.2* 1 CSIRO Marine Research, GPO Box 1538, Hobart, Tasmania 70012 Western Australian Department of Fisheries, PO Box 20, North Beach, WA 6920, Australia. Email: ahart@fish.wa.gov.auPearl oyster spat (Pinctada maxima) surveyed in the 80-Mile Beach section of the North West Shelf have been used in conjunction with outputs from a particle dispersion model to identify likely spawning grounds. The dispersion model consisted of a sophisticated three-dimensional circulation model for the region in which large numbers of individual particles were tracked over the period 1994 to 1999. From the settlement areas defined by the spat data, larvae were tracked back in time over their estimated pelagic phase of 24 to 31 days within the main spawning period of mid October to late December. Results demonstrate how large tidal currents in the region move larvae back and forth across the shelf. However, it is the lower frequency currents which mainly determine their net transport. While some model larvae traveled up to 100 km, most were transported less than 30 km. The implied spawning population tended to be concentrated northeast of the settlement sites and in slightly shallower water. This distribution is consistent with the observed distribution of Mother-of-Pearl.
Palaeobiogeographic and phylogenetic problems and solutions in the Australian fossil molluscan record Cook, Alex G.*1, Nützel, Alexander2, Fryda, Jiri 3, & Hocknull, Scott A.1 1. Queensland Museum, Geosciences 122 Gerler Rd Hendra Q 4011 Australia. Email: alexC@qm.qld.gov.au 2. Paläontologisches Institut, Lowenichstrasse 28, D-91054, Erlangen, Germany 3. Czech Geological Survey, Klarov 3/131, 118 21 Praha 1, Czech Republic. Continued examination of Mid Palaeozoic gastropod faunas indicates significant generic level links from eastern Gondwanaland to other disparate parts of the world. Biogeographic connectivity through the Devonian with the Europe, North China, Japan and even northern Alaska. This occurs even during periods of supposed maximum endemism. Even during cosmopolitan phases (eg, Late Devonian, Frasnian) faunal similarities reach new heights. Is this a case of island hopping throughout the Devonian across large marine distances? Examples from the Australian fossil record being ignored in some phylogenetic reconstructions have resulted in the misinterpretation of resultant phylogenies and molecular clocks for some groups. Significant opportunities exist for the detailed examination of the Palaeozoic origin of both "archaeogastropod" and other gastropod clades within the fossil record on this continent, examination of the rise of the first groups of non-marine gastropods, and the evolution of early meiofauna.
Long term trends in the world abalone market and the influence of this on the economic viability of abalone aquaculture Cook, Peter A. Centre of Excellence in Natural Resource Management, University of Western Australia, 444 Albany Highway, Albany WA 6330, Australia. Email: pacook@agric.wa.gov.au Continued increases in the production of farmed abalone, combined with an unfortunate proliferation of the illegal wild catch, have resulted in the current world supply of abalone nearing the historical abalone abundance of the mid 1970's. Sparked by the rising middle class in China, a global shift in both abalone availability and distribution has occurred. Although, over the past few years, farmed abalone production in China has increased almost exponentially, this has, surprisingly, not had a major effect on the international market price, primarily because almost all of the Chinese production is locally consumed. By contrast, however, the illegal trade in abalone has seriously undermined the legal industry. For abalone farmers, the factors that are most important in affecting economic viability are those such as local production costs and international currency fluctuations. These, and other factors, will be discussed using examples from both high-cost, and low-cost, production locations.
Form and function of the larval nervous system in molluscs Croll, Roger P. Dept Physiol. & Biophys., Dalhousie Univ., Halifax, NS, Canada B3H 4H7. Email: roger.croll@dal.ca
Recent studies have demonstrated that molluscs possess extensive larval nervous systems, which begin to develop by the early trochophore stage, and thus predate the first appearance of neurones within the ganglia of what will become the adult central nervous system. In addition, many of the larval neurones disappear after metamorphosis, as do the other larval structures (e.g., velum, retractor muscles), which they appear to innervate. Several studies have also demonstrated common features which are shared within the larval nervous systems of the various gastropods and bivalves examined to date. Specifically, serotonin is located only in cells with somata in the apical organ; the neuropeptide FMRFamide is generally located first in posterior cells although it can also be located in other cells including those within the apical organ; and catecholamines are located in small peripheral cells located around the velum and mouth and also in the foot. Finally, research is beginning to elucidate the roles of some of these neurones in the control of larval behaviour. For instance, both serotonin- and FMRFamide-containing cells appear to innervate the velar retractor muscle, thus suggesting roles in withdrawal behaviour and/or swimming and feeding. These latter behaviours also appear to be influenced by serotonergic and catecholaminergic control over ciliary beating along the velum. Together, such research illustrates a degree of complexity within molluscan larvae, which was unappreciated until recently and suggests new a new topic of concentration for the study of the evolution of larval forms within this phylum.
FMRFamide-like immunoreactivity in the central nervous system and periphery of Aplysia californica Croll, Roger P.*1, Staubach, Sid2, & Klussman-Kolb, Annette2 1. Dept. Physiol. & Biophys. Dalhousie Univ., Halifax, Nova Scotia, Canada B3H 4H7. Email: rpcroll@dal.ca2. Zool. Inst. der JW Goethe Univ., Siesmayerstrasse 70, 60054 Frankfurt-am-Main, Germany FMRFamide (Phe-Met-Arg-Phe-NH2), and related peptides, are among the best examined and most abundant invertebrate neuropeptides identified to date. The gene which encodes for these neuropeptides has been characterised in several species, including the well studied heterobranch gastropod, Aplysia californica, and FMRFamide-related peptides have been shown to be involved in such diverse functions as behavioural plasticity, motor programme generation and neuroendocrine function in this species. And yet, little is know of the identities of the various peptidergic neurones in either the central or peripheral nervous systems in A. californica. In the course of our studies of FMRFamide-like immunoreactivity, we identified numerous central neurones located in each of the various central ganglia. Many of these cells have not been previously described in this species. In addition, we also observed numerous peripheral cells, located in the gills, oesophagus and buccal mass, and also in and around the rhinophores and tentacles. By identifying novel cells and cell populations, this research suggests several new foci for examining neural control of specific behaviours known to be influenced by neuropeptides. The study also provides a basis for comparisons of possible cellular homologies between different species, thus contributing to an eventual understanding of how the nervous system accommodates the myriad changes in body plan and behaviour which have occurred during the evolution of gastropod molluscs.
Using molluscs to indicate loss of biodiversity and to test effects of its loss on the functioning of marine ecosystems Crowe, Tasman P. Department of Zoology, University College Dublin, Belfield, Dublin 4, Ireland. Email: tasman.crowe@ucd.ie Human activities are causing a reduction in global biodiversity, but the relationship between localised anthropogenic impacts, biodiversity and the functioning of ecosystems is poorly understood. There is an urgent need to develop indicators of loss of biodiversity and to predict the consequences of such loss for the functioning of ecosystems. Mussels are widely used as bioindicators. For example, physiological measurements on mussels form the basis for Scope for Growth (SFG), an indicator of integrated environmental stress. However, the effectiveness of SFG as an indicator of community level effects has rarely been tested in the field. In a study of six sites on the west coast of the UK, the diversity of macrofaunal communities associated with mussels was reduced at sites with low SFG compared to those with high SFG. These findings represent a significant step towards a biotic indicator of environmental quality which integrates impacts across a range of levels of biological organisation (from intra-individual to community). Ecological theory is being developed to predict the effects of loss of biodiversity on the functioning of ecosystems. Research to date have been controversial, with debate over the effects of losing numbers of species versus particular species and the potential for compensation for the loss of some species by others. A field experiment using cage enclosures was used to test the hypothesis that loss of diversity of grazing gastropods will affect the diversity of and potential export of production by intertidal algal communities. Results indicated that it is the identity rather than the number of species present that most strongly affects ecosystem function in this case. The loss of limpets Patella ulyssiponensis, alone or in combination with other species led to an increase in total cover of macroalgae. The function of Patella could only be fulfilled by increased densities of Littorina littorea and Gibbula umbilicalis under some circumstances. These studies demonstrate the value of molluscs as bioindicators and as model organisms for testing general ecological theories. Further research may enable us to bridge the gap between indications of environmental stress and predictions of impacts on ecosystem functioning.
Computerbased 3-dimensional reconstruction of major organ systems of Flabellina sp., a new aeolid nudibranch species from Brazil Da Costa, Simone1, Magenta, Carlo2, Simone, Luiz R.L.2, Schrödl, Michael1* 1. Zoologische Staatssammlung München, Münchhausenstr. 21, 81247 München, Germany; 2. Museu de Zoologia da Universidade de São Paulo, Caixa Postal 42594, 04299-970 São Paulo, Brazil Email: simonedacosta@gmx.de, carlomagenta@uol.com.br, lrsimone@usp.br, schroedl@zi.biologie.uni-muenchen.de Obtaining accurate and comprehensive structural data from dissecting tiny nudibranch specimens is a major problem. Analysis through dissecting is usually limited to a few organs, i.e. parts of the digestive and anterior reproductive organ systems. Even careful dissecting is destructive to a certain extent, and results thus are not always reproduceable. Histological methods and reconstruction of serial semithin sections allow additional character sets and tiny organs to be studied; graphical reconstructions by hand are, however, demanding, time-consuming, and not always accurate with regard to relative positions and proportions of organs. Using a small aeolidoidean species (8 mm body length) from Brazil, computerbased 3-dimensional reconstruction of serial sections with the software AMIRA is herein applied to nudibranchs for the first time. We obtained detailed and testable results on the central nervous, digestive, excretory and reproductive systems that are presented with their correct positions and proportions within the specimen. Especially the reconstruction of the tiny and complex cerebral nerves and anterior reproductive organs was greatly facilitated by the software. Analytical advantages include the possibility to follow certain structures (e.g. ducts) vertically through the different sections on the screen, and to directly control effects of different organ markings (i.e. identification) on the completely reconstructed organ system. The slender body of the specimens, combined with the triseriate radula with denticulate, horseshoe-shaped rhachidian and denticulate lateral teeth, indicates a generic placement within Flabellina. The unique body coloration and arrangement of the cerata, as well as the unique combination of special central nervous, radular and reproductive features shows Flabellina sp. to be an undescribed species.
How to radiate in a river - a reappraisal of fluviatile diversity in Tylomelania (Gastropoda, Pachychilidae) on Sulawesi, Indonesia Dames, Claudia, von Rintelen, Thomas* & Glaubrecht, Matthias Museum of Natural History, Humboldt University, Institute of Systematic Zoology, Invalidenstrasse 43, D-10115 Berlin, Germany. Email: thomas.rintelen@rz.hu-berlin.de
Recent surveys of rivers in southern Sulawesi revealed an astonishing degree of diversity, however. Tylomelania perfecta, for example, the first pachychilid described from the island, was considered highly variable and thought to occur throughout the whole pachychilid distribution range on Sulawesi. We present both morphological and molecular genetic data to show that T. perfecta must be split in several species complexes, with the nominal form being restricted to a small area around the type locality in South Sulawesi. Generally, the number of recognized species in southern Sulawesi is expected at least to double. Most riverine species differ by adult and embryonic shell characters, while the radula is almost identical. The lack of trophic differentiation probably prohibits species from coexisting at the same locality, which is reflected in the largely allopatric riverine distribution within Tylomelania. A striking exception to this pattern is found only in a small karstic area in Southwest Sulawesi where three species of Tylomelania co-occur. These species have very distinct radulae and, accordingly, exhibit clear substrate preferences, e.g. rock versus mud. This kind of trophic specialization has previously only been found in lacustrine species, where it is believed to be a key factor in their adaptive radiation.
The roles of bacteria, micro and macro algae as a feed for juvenile abalone in aquaculture Daume, Sabine*, Freeman, Kylie, Graham, Fiona & Davidson, Mark Research Division, Department of Fisheries, P.O. Box 20, North Beach, WA 6920, Australia. Email: sdaume@fish.wa.gov.au Abalone aquaculture in Australia is dependent on cultured algae to induce larval settlement and as a food source for the early life stages of abalone until formulated food is introduced into the growout system. In the natural environment, abalone larvae settle on coralline red algae, however, propagation of coralline red algae is not practical at commercial scale. Abalone farms in Japan successfully settle abalone larvae on the green alga Ulvella lens but U. lens had never been tested with Australian abalone species. We demonstrated earlier that U. lens is suitable to enhance settlement of both cultured southern Australian abalone species and most abalone farms in Australia are now growing U. lens for that purpose. U. lens is easy to culture, no specific facilities are needed and the alga can be grown on PVC settlement plates in commercial nursery tanks. However, U. lens has limited value as a feed for growing post-larvae. Instead, cultured diatoms can be added after larvae successfully settle and start feeding. However, juveniles abalone (>5mm in shell length) can consume U. lens and grow rapidly on this alga. Diatom cultures and biofilms developing on settlement plates are not axenic and the role of bacteria in early post-larvae feeding is poorly understood. Bacteria have been isolated from these diatom cultures and identified and strains and we are now tested in isolation and combination with respective diatom species. It has been suggested that bacteria may perform metabolic activities in the undeveloped gut of young post-larvae. At later stages of the nursery phase it becomes increasingly hard to maintain adequate feed on the plates and this is still regarded as a significant bottleneck for the industry. Recent investigations have indicated that sporelings of macroalgae like Ulva sp. may provide a suitable food source for juveniles (>3 mm in shell length).
The current status of Modiolus modiolus in Strangford Lough, Northern Ireland Davies1, Carys A., Picton2, B. & Roberts1, D. School of Biology & Biochemistry, The Queen’s University, Belfast BT9 7BL, 2. Bernard Picton, Curator of Marine Invertebrates, Ulster Museum, Belfast. Email: d.roberts@qub.ac.uk In the 1970s & 80s Modiolus beds were known to be extensive in Strangford Lough. The full extent of the beds was not reported in detail until the early 1990s by which time certain areas, particularly those occupied by the M. modiolus/ Chlamys varia community, were heavily impacted by mobile fishing gear. Trawling and dredging are known to damage biogenic reefs and seabed communities. Within Strangford Lough trawling has been reported as removing emergent epifauna. As a result of recommendations by the then Department of Agriculture for Northern Ireland (DANI), a number of legislative measures were introduced in 1993 to manage fishing activity. Comparison of the current with earlier diving surveys confirms the decline in Modiolus communities which are now very much reduced in extent and may no longer be in pristine condition. In sites where it was possible to collect population samples, population structure showed little differences from samples taken in the 1970s as a wide range of sizes were present and, there were individuals as small as 5mm which suggests that recruitment is still occurring. Mussel communities form a heterogeneous habitat. This comprises of the mussels themselves, an interconnecting byssal network with organisms living within this network as well as attached to the mussels and in biogenic sediments (faeces and pseudofaeces) which provide habitat for typically infaunal taxa. These communities attract opportunistic frequently predatory vagile species such as crabs and starfish which may have an important role in maintaining the diversity and complexity of the community and habitat. This poster outlines progress on the different components of the present study.
Gastropods as bioindicators? Direct measurements of metals over short time scales Davies, M.S. Integrative Biology, School of Health, Natural and Social Sciences, University of Sunderland, Sunderland, SR1 3SD, UK. Email: mark.davies@sunderland.ac.uk
Gastropods have been much less widely used as bioindicators of aquatic contamination than bivalves. But gastropods can offer advantages, particularly in the direct measurement of xenobiotic agents over short time scales. While these ‘traditional’ methods of measuring directly the presence of xenobiotics within the tissues suffer from no link with physiological function, they represent a first step in marking the exposure of animals to environmental contamination. They are often thought to temporally integrate exposure, but this need not be so. Here the utility of both the radula and pedal mucus of the common limpet, Patella vulgata are considered as potential biomarkers of metal contamination. Fifteen sites in north-east England were surveyed. While single and poly-metal granules were found in pedal mucus trails from all sites, the metal levels in mucus were greatest at contaminated sites. Mucus metal burdens were greater than those in the flesh by up to 2000 x. For Pb and Cd, limpets at contaminated sites could be releasing as much metal in their pedal mucus per day as is stored within the flesh. As a biomonitor, pedal mucus has advantages over the flesh because it may provide an ‘instantaneous’ measure of exposure and it is non-destructive. Although analysis of the radula is a destructive process, it has the potential to provide data over the period in which the radula forms: a few months at most. Radular metal levels varied across the sites, but not with consistency. Nevertheless, variations (e.g. Fe > 72 %, Cu and Zn >10-fold) were so great as to suggest an environmental cause. Lead is relatively high in mucus and radula which may suggest both are detoxification routes for Pb. As biomarkers, mucus and the radula may yet be established, but work on their relationship with the environment is necessary first.
Dayrat, Benoît Department of Invertebrate Zoology and Geology, California Academy of Sciences, 875 Howard Street, San Francisco, CA 94103, USA. Email: bdayrat@calacademy.org The fact that many species have been described under multiple names is a major problem: it makes the selection of names for well-delineated entities very difficult; it jeopardizes the estimation of alpha-biodiversity; it slows down the discovery of new species; it makes people wonder whether alpha-taxonomy is a science. A taxonomic revision of the 75 Discodoris species (Gastropoda, Euthyneura, Nudibranchia, Doridina) was performed, which involved 1 500 specimens dissected or examined (including all types available), 2 000 anatomical drawings, and 4 000 SEM pictures. Besides establishing synonymy or re-describing poorly known species, I identified four common mistakes explaining why so many species have been described under multiple names. New names have been created: 1) without considering all existing species; 2) without examining type material of existing species; 3) on the basis of incomplete (or erroneous) anatomical descriptions; 4) without taking into account individual infra-specific variation. One should not repeat these mistakes in the future if one wishes that alpha-taxonomy could become (and be perceived as) a rigorous discipline. In particular, it is critical that no new names could be introduced unless the anatomy of a species has been completed and character variation thoroughly addressed. Also, I will argue that in the future new names should be created only if type specimens are preserved in a way that makes DNA extraction and sequencing possible (so that one will be able to introduce type specimens in future phylogeography studies). Although 19 new morphotypes have been discovered during the present taxonomic revision, only a very few new species names will be introduced. Alpha-taxonomy needs a change in mindset: describing morphological diversity does not require naming any single set of specimens that differ from known species; taxonomists’ interests should shift from the creation of names to species delineation and character variation.
Short term toxicity of heavy metal combinations on the trochophore larvae of Radix quadrasi (Gastropoda: Pulmonata)
de Chavez, Emmanuel Ryan C . *Animal Biology Division, Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines Los Baños, College, Laguna 4031, Philippines. Email: radixquad@yahoo.com
Trochophore larvae (2-day old embryos) of the freshwater snail, Radix quadrasi were exposed to 0.0001, 0.001, 0.01, 0.1 and 1.0 mg/L Cu2+, Zn2+, Pb2+ and Cd2+ in petridishes filled 30ml freshly prepared solutions for 24h, 48h, 72h and 96h using static renewal toxicity test. Aged tap water was used for the control. Mortality for each metal concentration was initially determined. The median lethal concentrations (LC50) were then calculated using probit analysis. Based on the calculated LC50-96h, six metal combinations (Cu2++ Cd2+, Cu2++ Pb2+, Cu2++ Zn2+, Pb2++ Cd2+, Pb2++ Zn2+ and Zn2++Cd2+) were used to test their toxic effects on the snail larvae. Each petridish was filled with a mixture of the 50% LC50 of two heavy metals and exposed for 96h. All treatments were done in three replicates. The LC50-24h showed that Cd2+ (0.098 mg/L) was the most lethal to the larvae followed by Pb2+ (0.299 mg/L), Zn2+ (0.324 mg/L) and Cu2+ (0.493 mg/L). The toxicity trend after 48h was Cd2+ (0.032 mg/L) > Zn2+ (0.062 mg/L) > Cu2+ (0.074 mg/L) > Pb2+ (0.290 mg/L) while after 72h, Cu2+=Cd2+ (0.023 mg/L) > Zn2+ (0.062 mg/L) > Pb2+ (0.250 mg/L), respectively. On the 96h exposure, the trend was Cu2+ (0.015 mg/L) > Cd2+ (0.016 mg/L) > Zn2+ (0.017 mg/L) > Pb2+ (0.194 mg/L). The combination of two non-essential metals (Pb2++Cd2+) had the highest mortality (68.52%), followed by Zn2++Cd2+ (25.22%), Cu2++ Cd2+ (25.22%), Pb2++ Zn2+ (16.97%) and Cu2++ Pb2+ (12.76%). The mixture of two essential metals (Cu2++ Zn2+) however, yielded the lowest mortality (9.02%). The results of this study indicated that R. quadrasi larvae are very sensitive to heavy metals. Thus, they are potential biological indicator of freshwater heavy metal pollution.
The shaping of a species: the Azorian Drouetia Gude (Pulmonata: Zonitidae: Oxychilus) as a model de Frias Martins, A.M. CIRN and Departamento de Biologia, Universidade dos Açores, 9501-801 Ponta Delgada, Portugal. Email: frias@notes.uac.pt
Speciation is a multifaceted process leading to the isolation of a parcel of a previously wider gene pool. From molecules to the individuals that carry them to the populations they live within, variability and selection, led by the patient hand of time, interact differently at every of these levels to produce the genetic oddities we call species. The road to speciation usually shows different levels of definition of such interaction. Morphology, the readily visible face of evolution, constitutes a basic indicator of the speciation event, and analysis of the patterns of its distribution may point to the framework of the process. Spread throughout the archipelago and apparently free from visible biotic pressure, the endemic Drouetia provide a suitable model to study aspects of this process and the Azores constitute an adequate laboratory to research it. The geographical position and distribution of the islands, their different ages and the rhythmicity of the volcanic events that originated them provide an adequate scenario in which various stages of speciation can be found, thus allowing for extrapolations about the process. From the observed pattern of distribution of intra- and interspecific morphological/anatomical variability in Drouetia we may advance the following scenario: Stage one: demic (allopatric) variability; it is postulated that volcanic instability (cyclic eruptions) and intense erosion (deep ravines) create temporary isolates that (?100 yrs) later merge into a new genetically richer population. Stage two: close sympatric (interspecific) variability; it is postulated that short-term (>0.5 My) volcanic stability contributes to consummate speciation. Stage three: extreme sympatric (interspecific) variability; it is postulated that long-term volcanic stability (>1 My) leads to supra-specific differentiation.
Tropical abalone aquaculture genetics: how gene discovery and analysis informs hatchery practices Degnan, Bernard M.* & Jackson, Daniel Dept of Zoology & Entomology, University of Queensland, Brisbane 4072, Australia. Email: bdegnan@zen.uq.edu.au
In the face of a growing demand worldwide for ‘cocktail’-sized abalone, we are using our studies of the biology of the tropical species Haliotis asinina to develop a suite of hatchery practices. Here we highlight our analysis of genes involved in a number of commercially-important traits, specifically larval settlement, reproduction, growth and shell production. Analysis of neutral gene markers – mitochondrial and microsatellite loci – has identified distinct H. asinina stocks in the Indo-Pacific and has shed light on fertilization dynamics in the hatchery. These data in turn have contributed to the implementation of a set of hatchery practices designed to maximize genetic diversity of reared offspring. We are studying regulatory genes that control a wide range of developmental and physiological processes (e.g. Hox, Sox and POU transcription factor genes). Our goal is to understand their roles in constructing the abalone body plan and in controlling the apparent antagonism that exists between growth and reproduction. The differential expression of these genes during reproduction and growth suggests they play a key role in regulating the abalone’s physiology and thus may be appropriate as future targets of selection and genetic enhancement programs. We have used these genes to determine if castrating factors released by a parasitic digenean trematode can be used to promote high growth in aquaculture. High-throughput gene expression analyses are being applied towards identifying the optimal larval age to induce settlement, thermal tolerance, growth and shell production. This approach has lead to the discovery of gene batteries consisting of hundreds of genes who each contribute to the trait of interest. Importantly, the conservation of haliotid genomes suggests that genetic insights into H. asinina development, physiology and structure will be directly applicable to other commercially-important abalone species.
Phylogeography and systematics of the IndoPacific tropical abalone Haliotis asinina Degnan, Sandie M.1, Imron1, Geiger, Daniel L.2, & Degnan, Bernie M.1* 1 Department of Zoology and Entomology, The University of Queensland, Brisbane 4072, Australia. *Email: b.degnan@uq.edu.au2 Santa Barbara Museum of Natural History, Santa Barbara, CA, USA
Abalone (Haliotidae) are marine gastropods found world-wide along the temperate and tropical coasts of both hemispheres. Currently, 56 species are recognised. Cladistic morphological and molecular analyses agree that southern hemisphere species form a distinct clade from the rest. We use a mitochondrial DNA gene – cytochrome oxidase II (COII) – to examine evolutionary relationships among 12 IndoPacific species of Haliotis. Included are three widespread tropical species, five temperate endemic Australian species, three New Zealand endemics and a South African endemic. Tree topologies were generally consistent across distance, parsimony, maximum likelihood and Bayesian methods of tree reconstruction. A monophyletic clade containing the five Australian endemics suggests a single invasion of Australian temperate waters, followed by speciation in situ. A South African endemic, H. midae, appears to be a robust sister taxon to the temperate Australian clade. The three New Zealand endemics apparently represent two independent invasions. Relationships among the three widespread tropical species – H. asinina, H. varia and H. ovina – cannot be clearly resolved by our data, but all three appear to represent relatively old species, with substantial intraspecific diversity. We further investigated the pattern of COII diversity across the distribution of one of the tropical species, the type species of the genus, H. asinina. A total of 130 individuals from 11 sampling localities in Australia, Indonesia, Malaysia, The Philippines and Thailand revealed a deep divergence between eastern Australian populations (the Great Barrier Reef) and all remaining samples. Pairwise comparisons of mtDNA haplotype frequencies indicate recent restricted gene flow even between geographically close populations, consistent with the relatively short larval stage. Historically, the geographically unstructured distribution of haplotypes across the species’ range suggests allopatric evolution of isolated populations when sea levels were low during the last ice age, followed by rapid spread and mixing of these populations when sea levels rose again.
Sensitivity to cadmium along a salinity gradient in the periwinkle Littorina littorea, using time-to-death analysis De Wolf, H.1, Van den Broeck, H.1, Blust, R.1 & Backeljau, T.*1,2 1. University of Antwerp, Department of Biology, Groenenborgerlaan 171, B-2020 Antwerp, Belgium. Email: hans.dewolf@ua.ac.be 2. Royal Belgian Institute of Natural Sciences, Vautierstraat 29, B-1000 Brussels, Belgium In this study we assessed the combined effect of Cd concentration and salinity, on Cd uptake and mortality rate of Littorina littorea, collected along a salinity and pollution gradient in the Western Scheldt estuary (The Netherlands). Animals kept at their field salinity levels were exposed to three Cd concentrations (i.e. 10, 40 and 320 µM), while animals kept in 10 µM of Cd were subjected to five salinity treatments (i.e. 15, 20, 25, 30 and 35‰). Mortality was recorded every 24 hours and Cd body burdens were measured with ICP-AES. Time-to-death data were analysed via Cox proportional hazard models, including the covariates "site-Cd treatment" in the Cd experiment and "site-salinity treatment" in the salinity experiment. "Cd-treatment" and "field-salinity" affected mortality rates significantly in the Cd experiment, such that the mortality risk increased by 2.3 times when salinity was lowered from 35‰ to 15‰, while it decreased by 19.7 times when Cd dropped from 320 to 10µM. "Site" did not significantly affect the mortality risk in the salinity experiment but affected time-to-death via its interaction with the "salinity-treatment". Generally, mortality did not occur at a given threshold Cd tissue level, but changed over time and treatments, in function of the site. The results demonstrate the importance of the animals’ environmental history and illustrate the usefulness of time-to-death analyses in ecotoxicological experiments. C concentrations in estuarine molluscs - a comparative investigation of place, time and taxon Dussart, Georges*, Trigwell, Jacqueline & Dussart, Alastair Ecology Research Group, Canterbury Christ Church University College, Canterbury, Kent, UK CT1 1QU. Email: gbd1@cant.ac.uk As a 'soft' beta radiation emitter, artificially generated 14C is increasingly used as a radiotracer in medicine and research. With a half-life of 5730 years, 14C can persist in ecosystems. Although disposal is to atmosphere, land-fill or sewers, it eventually finds its way to the hydrosphere. In an analysis of variance design, the whole body concentration of 14C was monitored for 13 months in wild gastropod molluscs Littorina littorea, Hydrobia ulvae and the bivalves, Cerastoderma edule, Mytilus edulis and Macoma balthica. Three small (circa 2-10 km in length) topographically similar estuaries were compared - one in South East England (Stour) and two in North East England (Aln & Coquet). Data for the Aln and Coquet were not significantly different from each other and were merged. The Stour is more affected by general pollution than the Aln-Coquet. Although results were close to background levels, statistically significant effects were seen. Shells had higher activities of 14C than soft body parts (F1,576~7.83 P=0.005), and shells showed different activities suggesting different patterns of accumulation. Significant differences between the taxa were more clear for soft body than for shell, and taxa could be ranked Cardium (highest concentration)>Mytilus>Littorina=Hydrobia>Macoma. 14C concentration changed over time (F13,577~ 8.12 P<0.0001), rising to a peak in June, and followed by a dip in July and August. Soft body parts showed no significant differences between the Stour and the Aln-Coquet (F1,385~0.43 P=0.51). By contrast, shell analysis showed highly significant differences (F1,252~8.78 P=0.004), suggesting that there is a a low-level accumulation of 14C in shells. A caged mussel experiment on the Stour showed increased 14C downstream of an industrial discharge (F3,120~4.09 P=0.009). As radioisotopes become increasingly important in molecular biology, attention may need to be paid to their assimilation into ecosystems. In addition to 14C, the radioisotopes 3H, 33P and 35S might be usefully investigated in future.
The phylogenetic affinities of northern Pacific chitons Eernisse, Douglas J. Department of Biological Science, California State University, Fullerton, CA 92834 USA. Email: deernisse@fullerton.edu A northern Pacific chiton clade with tremendous morphological disparity has been revealed by new mitochondrial (partial 16S rDNA and cox I) sequence comparisons of these and many other chiton genera. Current chiton classifications include six genera in Mopaliidae Dall, 1889: Mopalia Gray, 1847, Plaxiphora Gray, 1847, Amicula Gray, 1847, Placiphorella Dall, 1879, Placiphorina Kaas & Van Belle, 1993, and Katharina Gray, 1847, diagnosed especially by a posteromedian sinus on the tail valve. Sequence results indicate that the southern hemisphere Plaxiphora (and probably Placiphorina) is only distantly related, and should be removed from Mopaliidae. Taking its place will be three other northern genera, conventionally assigned to other families, supported as close relatives of Mopalia: Dendrochiton Berry, 1911, Tonicella Carpenter, 1873, and Cryptochiton von Middendorff, 1847. Transferring Cryptochiton to Mopaliidae is appealing because its former family is more southern than Cryptochiton, plus juvenile Cryptochiton show striking resemblance to adults of the far northern mopaliid genus, Amicula (whose DNA remains unsampled). A sister-taxon grouping of Dendrochiton + Mopalia is supported by sequence comparison, and both genera have bristle-like girdle setae. However, Dendrochiton has a "typical" posterior valve with no sinus. This implies that the characteristic sinus of Mopalia arose convergently to the sinus of more basal mopaliid genera, Placiphorella and Katharina, or the "unrelated" southern hemisphere Plaxiphora. In Mopalia, the terminal sinus makes room for a "chimney" formed by the often slit girdle, and this helps direct respiratory flow vertically away from the body. The newly recognized clade is comprised of small to extremely large and ecologically important chiton species, produced by a spectacular radiation in the shallow waters of the northern Pacific and nearby Arctic Ocean. Exceptions include a few northern Atlantic species of Tonicella or Placiphorella, but their similarity to specific Pacific counterpart species suggests a more recent dispersal history.
Maturation timing in the land snails, Archachatina marginata ovum (Pfeiffer) and Limicolaria flammea (Muller) (Pulmonata: Achatinidae) Egonmwan, Rosemary I. Department of Zoology, University of Lagos, Akoka, Lagos, Nigeria. Email: egone@infoweb.com.ng The timing of gonadal maturation was studied in two edible species of West African achatinid, Archachatina marginata ovum (Pfeiffer) and Limicolaria flammea (Muller), using light microscopic observation of gametogenesis in the ovotestis. Additionally, the growth of the reproductive system was analysed by monthly measurement of body weight, shell length and reproductive system. The ovotestis in Archachatina marginata ovum and Limicolaria flammea produces simultaneously eggs and spermatozoa. Histological studies show that the cycle in the two snails could be divided into 5 active and 2 inactive gametogenic stages, which are described and compared in both species. Spermatogenesis appears first when L. flammea is about one month old while oocyte growth starts at a slightly later date when the animal is about 4.5 months old. Spermatogenesis starts when A. marginata ovum is about 6 months of age and oocyte development starts in 12 months of age. The first oviposition occurs approximates 19 months of age in A. marginata ovum and 5 months in L. flammea. Genitalia develop after the onset of gametogenesis in both snails with the male system developing before the female system. The timing of reproductive maturation differs in the two species: L. flammea which live between 12 and 22 months in the laboratory has one or two breeding season and the maturation of the gonad is timed to coincide with this active reproductive phase while A. marginata ovum that live for up to 8 years has yearly breeding over 3 years, hence there is probably a cyclical maturation of the gonad with a period of rest during each year.
The body-wall musculature of Meioherpia atlantica (Solenogastres: Dondersiidae) and Helminthope psammobionta (Opisthobranchia: Rhodopemorpha) – primary and secondary molluscan worms Eheberg, Dirk & Haszprunar, Gerhard Zoologische Staatssammlung München, Munich, Germany. Email: haszi@zsm.mwn.de Outgroup comparison and recent phylogenetic analyses suggest that molluscs were originally small and vermiform animals, and that the Solenogastres are the first molluscan offshoot. In order to compare the original vermiform body with a secondary vermiform body, we compared the body musculature of a solenogastre species, Meioherpia atlantica Salvini-Plawen, Rieger & Sterrer, 1985 and Helminthope psammobionta Salvini-Plawen, 1991, which is an highly adapted, interstitial opisthobranch gastropod. SEM, TEM and immunostaining techniques combined with confocal laser scanning microscopy provided the following results: Both species occur in similar clean sands and locomote slowly by using solely their epidermal ciliation, but Helminthope psammobionta can move and retract its body to a much higher extend. The body-wall musculature of both species contains outer ring and inner longitudinal muscle fibres, the latter are (less in Meioherpia, very significant in Helminthope) strengthened along the ventral side of the body. In general all body muscles are of the smooth type, and in both species there is no trace of an epithelial organization of the body wall musculature. However, whereas intercrossing diagonal (better helicoid) muscle fibres are present in Meioherpia atlantica, these are entirely lacking in Helminthope psammobionta. Since other worm taxa like turbellarian flatworms, nemertines or interstitial polychaetes also show diagonal muscle fibers, these are considered as a plesiomorphic character of the primary vermiform body of Solenogastres, while the gastropod secondarily lack this character. It is noteworthy that the solenogastre shows smooth buccal muscles, whereas all higher Mollusca have buccal muscles of the cross-striated type usually combined with a myoglobin-system of cell-respiration.
Phylogenetic relationships among the Iberus gualterianus-alonensis complex (Gastropoda: Helicidae) group inferred by mtDNA partial sequences (16SrRNA, COI) Elejalde, A. 1*, Muñoz, B.2, Arrébola J.R. 3, Cárcaba, A. 3, Ruiz, A. 3 & Gómez-Moliner, B.J. 1 1 . Dpto. Zoología y B.C.A; Fac Farmacia; Univ. País Vasco; c/ Paseo de la Universidad, 7. Vitoria 01006. Spain. ggpgomob@vc.ehu.es2 . Dpto Biología Animal 1; Fac. Biología; Univ. Complutense Madrid. Spain.3 . Dpto. Fisiología y Biología Animal; Fac. Biología; Univ. Sevilla. Spain.The genus Iberus Montfort, 1810 is an endemism of the Iberian Peninsula. This genus includes 20 morphospecies but their taxonomic validity is under discussion. They preferably live in the south of Spain (Andalucía) and they extend from mediterranean coast to the Ebro Valley and Catalonia as a limit. I. alonensis (Férussac, 1821) is spread throughout this area while I. gualterianus (Linnaeus, 1758) is isolated to three restricted localities, Sierra Elvira in Granada, Sierra de Jaén in Jaén and Sierra de Gádor in Almería. Some taxa show a high variability in their shell form. This is the case of I. gualterianus and I. alonensis the two most representative species in this genus. The former has a keeled shell with a marked reticulate sculpture while I. alonensis has a rounded shell with a thin radial and spiral striation. Some authors consider them as two ecotypes of the same species, with the keeled shells adapted to live in limestone rock crevices and rounded shells adapted to soft substrates, while others consider them like valid species. In this work, we used the molecular techniques to clarify the phylogeny of these taxa using two loci of mitochondrial DNA: 16S rRNA and cytochrome I oxidase (COI). Sequences were analyzed using parsimony and neighbour-joining (NJ) in PAUP version 4.0b10, and maximum-likelihood analysis in Puzzle 5.0. Hygromia limbata and Pseudotachea splendida were used as outgroups.The phylogenetic trees showed that I. gualterianus is a monophyletic group with the three populations grouped in a polytomic clade, indicating absence of genetic differentiation. I. alonensis showed four different lineages each one with each own geographic range. On the basis of these results, the phylogenetic relationships of I. gualtierianus, I. alonensis, I. campesinus and I. alvaradoi are discussed. This study has been financed by the projects 1/UPV 00076.125-E-13713/2001. REN2002-00716
Phylogenetic analysis of Pyrenaearia (Gastropoda, Pulmonata) based on 16S rRNA and COI mitochondrial genes. Elejalde, A., Puente A.I., Madeira, M.J., & Gómez-Moliner, B.J. * Dpto. Zoología y B.C.A; Fac Farmacia; Univ. País Vasco; c/ Paseo de la Universidad, 7. Vitoria 01006. Spain. ggpgomob@vc.ehu.es Pyrenaearia Hesse, 1921 is an endemic genus of the northern mountains of Iberian Peninsula that currently comprises about 12-16 species of uncertain validity, exclusively differentiated on the basis of shell morphology. In order to clarify the taxonomy of Pyrenaearia, we have studied the sequences of COI and 16S rRNA mitochondrial DNA genes after PCR amplification. The phylogenetic analyses were made using parsimony and neighbour-joining in PAUP 4.0b10, and maximum-likelihood analyses in Puzzle 5.0. Hygromia limbata and Pseudotachea splendida were used as outgroups. Phylogenetic reconstruction showed two major clades. The Pyrenaearia species living in the Cantabrian Mountains constitute the first great monophyletic group. Here P. oberthueri and P. poncebensis are considered synonymous of P. schaufussi. The species inhabiting the Pyrenees, Basque Mountains, Moncayo Massif and Pre-littoral Catalonian System were grouped in the second monophyletic clade. In this group P. transfuga is closely related to P. velascoi and is proposed as a subspecies. P. esserana is considered synonymous of P. carascalopsis. Only 11 species should be considered inside the genus on the basis of this mtDNA regions. Three of them (P. cantabrica, P. schaufussi and P. daanidentata) inhabite Cantabrian Mountains. P. velascoi is present in the west Pyrenees (P. v. transfuga) and in the Basque Mountains (P. v. velascoi). Another three species are restricted to the axial portion of the Pyrenees (P. carascalensis, P. carascalopsis and P. cotiellae). Three more species are restricted to small and isolated regions placed in the southeast pre-Pyrenees (P. parva and P. organiaca) or in Pre-littoral System of Catalonia (P. molae). Finally, P. navasi lives in the Moncayo Massif, being the only species that is present at the south of the Ebro valley and the only one that lives in non-limestone substrate. This study has been financed by the University of the Basque Country projects: 1/UPV 00076.125-EA-7876/2000 and 1/UPV 00076.310-E-15256/2003
The nudibranch diversity and zoogeography of central Norway Evertsen, Jussi1* & Bakken, Torkild2 1. Trondhjem Biological Station, Dep. of Biology 2. Section of Natural History, Norwegian University of Science and Technology, NO-7491 Trondheim, Norway. Email: jussi.evertsen@bio.ntnu.no A project focusing on the diversity and zoogeography of nudibranch molluscs (opisthobranchs) in central Norway is about to reach a settlement of conclusions. The project was initiated in 1997 in light of a report of the marine macro-benthic fauna of the Norwegian coast, revealing that the nudibranch diversity was poorly known. The aim of the project was therefore to survey the diversity of nudibranch species in central Norway, thoroughly examine the existing collections of nudibranchs at the Museum of Natural History and Archaeology in Trondheim, revise known distribution and literature, pinpoint problems in taxonomy and nomenclature, present new data, and revise the distribution of each species. Synthesis of the project so far has revealed a lot of new information in a short time period (1767-1942 vs 1997-2004), due to an effective method of sampling and observation (diving). Also, of the reported nudibranch diversity (1997), new records for the investigated sectors increased with 18-38%, four new records for the Norwegian coast were also discovered, and the zoogeographic status of several species were altered. Together with a literature review, examination of deposited material at the Museum and own collections and observations, the nudibranch diversity of central Norway consists of 62 species, with a total count for the entire Norwegian coast (excluding Bear Island and Svalbard) of 83 species. Six species are considered to have a doubtful taxonomic status. The zoogeographic status of the nudibranch fauna in central Norway is dominated by boreal species, with 40% having a distribution both north and south of Norway (pan-sectoral distribution), 57% having a southern distribution with a northernmost border somewhere in Norway, and 3% having a northern distribution with a southernmost distribution somewhere in Norway. 6 species are endemic to the area.
Photosynthetic activity in sacoglossans Evertsen, Jussi1* & Burghardt, Ingo2 1. Trondhjem Biological Station, Dep. of Biology, Norwegian University of Technology and Science. Email: jussi.evertsen@bio.ntnu.no 2. Ruhr-Unveristy, Bochum, Spezielle Zoologie, Germany. ingo.burghardt@rub.de Sacoglossan molluscs (opisthobranchs) are specialised herbivores feeding suctorially on marine macroalgae and seagrasses. Morphological and physiological adaptations have enabled them to incorporate intact chloroplasts and keep them photosynthetically active in the digestive cells for varying time periods. The extent of chloroplast functionality and different levels of chloroplast retention, also termed kleptoplasty, have been reviewed in several papers, suggesting that incorporation and retention of chlorplasts varies from non-retention (chloroplasts are food) to long term functional retention (photosynthetic activity in starved animals up to 10 months). Until recently, the process of determining if the incorporated chloroplasts are photosynthetically active or not, and their operating time within the digestive cells, were time consuming and detrimental methods. By using a Pulse-Amplitude-Moludation measuring principle with a DIVING-PAM as a quick and reliable method allowing the measurement of photosynthetic activity in chloroplasts, the photosynthetic activity in 13 sacoglossan species from the Mediterranean Sea and the Indo-Pacific has been investigated. The results reflect a varying utilisation of chloroplasts. Of the investigated taxa, the Caliphyllidae did not show any photosynthetic activity, and would fall within non-functional retention. The remaining ten species all showed photosynthetic activity for more than 24 hours. Previous definitions of chloroplast retention within the sacoglossa have been delimited to non-retention (immediate digestion), short term to medium non-retention (photosynthetic activity up to 24 hours), short term to medium functional retention (photosynthetic activity for more than 24 hours), and long term functional retention (photosynthesis persist for more than a week). Our results sugest that these definitions are insufficient, showing most of the investigated Elysiid species to fall within photosynthetic activity from two to 15 days. Three other Elysiid species show prolonged photosynthetic activity beyond 40 days, but with different photosynthetic activity characteristics.
Molluscs as models for examining evolutionary complexities Fahey, S.J. California Academy of Sciences, 875 Howard Street, San Francisco, California 94103 USA. Email: sfahey@calacademy.org Several approaches to examining the evolutionary complexities of organisms have been tested over the past several decades. Specifically, morphological and molecular data sets from DNA sequences are the most widely used methods to test an evolutionary hypothesis. Nudibranch molluscs were used as a model to test the application of several data sets on an existing hypothesis of relationships derived from morphological data at a species level. The results of the study found that two of the four data sets used, DNA sequence data and morphological characters, provided the most information when measured in robustness of the phylogeny, cost and time spent on the project. Two additional data sets used, sperm morphology and natural products chemistry were found to be valuable at higher taxonomic levels. Conclusions from the study indicate that combinations of data can provide valuable insight into evolutionary relationships, allowing the researcher to further examine the hypothesis from various perspectives. Those perspectives include the molecular evolution of the organism, morphological character evolution, chemical evolution and reproductive evolution at a cellular level. The complexities of evolution are more clearly illuminated by a multidisciplinary approach.
Using sperm ultrastructure to examine a species-level phylogeny Fahey, S.J.*1 & Healy, J.2 1. California Academy of Sciences, 875 Howard Street, San Francisco, California 94103 USA. Email: sfahey@calacademy.org 2. Malacology Section, Queensland Museum, PO Box 3300, South Brisbane, Queensland 4101, Australia Sperm ultrastructure has been used infrequently as a means to address taxonomic and/or phylogenetic questions within the Nudibranchia. Previous studies had not found any sperm synapomorphies uniting the Nudibranchia although possible relationships within the Doridoidea have been elucidated. The present study examined the sperm from at least one representative of each major clade within one genus of nudibranchs to determine if sperm characters could be used to support the existing morphology-based phylogeny. The study generated some surprising and intriguing results, especially in light of recent taxonomic/phylogenetic studies. No sperm characters could be found that clearly define the clade traditionally considered to represent the genus Halgerda. No close correlation was obvious between sperm features and the proposed clades within the genus, and the outgroups selected by previous authors were found to be appropriate when using sperm morphology to examine relationships among the Nudibranchia. Lastly, the wide diversity of morphology among the Discodorididae could be interpreted either as indicative of a rapidly evolving group or as possible evidence against the monophyletic status of this family.
Micromolluscan records and paleoenvironmental change of Yongshujiao reef, South China Sea, in the late Holocene Feng Weimin, Lan Xiu, Cai Huawei & Pan Huazhang Nanjing Institute of Geology and Palaeontology, Chinese Academy of Sciences, 210008, Nanjing, China Nanyong 3 core, drilled at the Yongshu reef lagoon in the center of South China Sea, contains late Holocene deposit of 5.9m long. 160 microgastropod species and 27 microbivalve species, collected from 88 samples in the core, have been identified. Main gastropod species are Acteocina coarctata (A.Adams, 1850), Acteocina exilis (Dunker, 1859), Boschitestella eloiseae Moolenbeek, 1994, Cerithidium fusca (A.Adams, 1860), Cerithiopsis ingens Bartsch, 1907, Cerithium (Thericium) elegantulum Speyer, 1867, Circumstella biconcave, Clathrofenella reticulata (A. Adams, 1860), Diniatys dentifer (A. Adams, 1850), Lophocochlias minutissimus (Pilsbry, 1921), Merelina wanawana Kay, 1979, Omalogyra cf. atomus Philippi, 1841, Orbitestella bermudezi (Aguayo & Borro, 1946), Orbitestella decorata Laseron,1954, Plesiotrochus acutangulus (Yokoyama, 1924), Retusa (Ventomnestia) bizonata A.Adams,1855, Ringicula durodai (Takeyama, 1935), Ringicula columnifera Feng, 1991, Scissurella coronata Watson, 1885, Tricolia variabilis (Pease, 1860), Turbonilla eupellucida Normura, 1937. Main bivalve species are Condylocuna flemingi Maxwel, Borniopsis ariakensis Habe ,Cadella semitorta (Reeve), Wallucina (Wallucina) xishaensis Lan. The micromollusks are mainly characterized by tropical representatives according to their distribution in southern sea area of Japan, Hawaii, Persian Gulf, Bahamas and Australia etc.Because every sample of the core contain very abundant mollusk individuals, from about 200-300 to over 1000 individuals per 10g sample, quantificational analyses would be allowed for paleoenvironmental reconstruction over the last 1800 years. Based on nine age values of TIMS U system dating, we made comparison between depositional rates (cm/a) of the sediments and the accumulated rate (Ind./a) of micromollusk shells and find a significant phenomena: accumulated rate of micromollusks is low at very high or low depositional rate of sediments but is high at both moderate sedimental rate and stable sedimental environment. Four stages of depositional environmental changes in last 1700 years are hereby preliminarily recognized as following: depositional environment in 1400-1700 a B.P. is unstable with low accumulated rate of micromollusks; stable in 900-1400a B.P. with high accumulated rate of micromollusks; sharp turbulence in 400-900a B.P with low accumulated rate of micromollusks; very stable in 1-400 a B.P. with very high accumulated rate of micromollusks. The environmental changes might be caused by profound climatic and marine background. Research further reveals that variability of micromollusk abundance and diversity in the core is characterized by three high values and three low values that can correspond to curve of oxygen isotope and temperature anomaly of northern hemisphere. For example, In the last 1000 years there are two high values and one low value of micromollusk abundance that are comparable with the "Medieval Warm Period", with the "Little ice age" and with recent warm period, respectively. Between the "Medieval Warm Period" and the "Little Ice Age", the temperature anomaly and the variability of micromollusk abundance were all shown by frequent undulation. This indicates that the climatic events over short scale may spread to sea area around tropic zone and exert influence on micromollusk development. This research is supported by Chinese Natural Science Foundation of China (40176030).
Studies of bivalve pump dynamics using new techniques Frank, D.M., Ward, J.E. & Shumway, S.E.*
Debate regarding mechanisms of pumping and its control in bivalve molluscs continues. One view contends that pumping activity is autonomously regulated, proceeding at a constant rate approximately equal to maximum theoretical values. The second view supports physiological regulation and implies an adjustment of filtration rate according to environmental cues in order to meet nutritional needs. Arguments have assumed that all bivalves have similar feeding strategies. Further, models of bivalve pumps have been based predominantly on experiments with the mussel, Mytilus edulis, and may not adequately explain pumping by bivalves with different gill types. We are examining individual components of feeding activity (pallial cavity pressure, valve gape, and inhalant and exhalant flow velocities) using a low-pressure/valve-gape system and particle image velocimetry. These components are being investigated in three different species of bivalve molluscs, each with a unique gill morphology: oysters, Crassostrea virginica; mussels, Mytilus edulis; and scallop, Placopecten magellanicus. While current models of bivalve pump characteristics will be used to establish starting points, we suspect the relationships among the various components of feeding activity will be species specific. These experiments will provide data on pumping activity and behavior of three bivalve species and insight into if and how bivalves control pumping performance. A broodstock conditioning trial with greenlip abalone (Haliotis laevigata) in Western Australia Freeman, Kylie1*, Daume, Sabine1, Rowe, Matthew1,2, Maguire, Greg B.1, Parsons, Steve2 & Lambert, Rick2 1. Research Division, Department of Fisheries PO Box 20, North Beach WA 6020, Australia 2. Great Southern Marine Hatcheries, PO Box L34, Little Grove, Albany WA 6330, Australia. Email: kfreeman@agric.wa.gov.au Managing the broodstock conditioning process is very important to the successful establishment of an abalone industry that can reliably produce juveniles from captive stock. The ability to have ripe individuals year-around or at predictable times in the year allows the culturist to schedule the hatchery process to occur at the most favourable time of the year for growth and survival to conduct selective breeding. Four conditioning periods of 6, 8, 10 and 12 week intervals were tested, using a constant conditioning temperature and ambient temperature as a control. Broodstock were collected from the wild and range from 87.5 to 142.1mm in shell length and 108.2 to 482.8g in whole weights. Greenlip abalone were spawned all year round and large numbers of "out of season" spawnings were recorded particularly with conditioned stock. Over the whole trial period, greater egg production from prescheduled spawnings occurred in the conditioned group with an average of 1.7 x 106 eggs per tub of 5 female abalone, compared to abalone held in the control tubs that only produced an average of 0.4 x 106 eggs per tub. The group that was spawned every 8 weeks produced the largest average number of eggs per holding tub. There was very little difference between conditioning periods in terms of number of successful spawnings per spawning round. The egg production for all planned spawnings was highest before the "natural spawning season" for greenlip abalone. In comparison, the highest numbers of unplanned spawnings occurred around the natural spawning period for both the conditioned and control groups. Handling of broodstock abalone prior to spawning reduced the number of eggs produced per tub of abalone but did not affect the number of successful spawnings per spawning round. Histological examination showed that using the visual gonad index is not a good indication of maturation of the abalone but it confirmed that abalone can be conditioned out of season.
Phylogeny of Paleozoic gastropods and origin of larval planktotrophy Frýda, Jiri Czech Geological Survey, Klarov 3/131, 11821 Praha 1, Czech Republic. Email: bellerophon@seznam.cz Phylogenetic relationships of Palaeozoic gastropods inferred from their early shell ontogenies as well as their stratigraphic ranges are briefly discussed. New data on Silurian and Devonian gastropods revealed that the main groups of living gastropods (Archaeogastropoda, Neritimorpha, Caenogastropoda, and Heterostropha) had diverged before the middle Palaeozoic. A characteristic feature of early Palaeozoic gastropods is the development of a large embryonic shell, reflecting their lecithotrophic larval strategy. These gastropods belong to taxa developing (Neritimorpha, Cyrtoneritimorpha, Perunelomorpha, Mimospirina, and Amphigastropoda) or lacking (Archaeogastropoda and Euomphalomorpha) a true larval shell (protoconch II). The initial whorl of most early Palaeozoic gastropods was openly coiled. This morphology was changed dramatically during the Late Silurian and Early Devonian. The vast majority of those forms was replaced gradually by gastropods developing a relatively small embryonic shell and having tightly coiled initial whorls. This major macroevolutionary trend in larval shell morphology coincided with the inception of larval planktotrophy, and was followed by the late Paleozoic radiation of Neritimorpha, Caenogastropoda, and Heterostropha. The inception of larval planktotrophy also coincided with fundamental changes in the biogeochemical evolution of the Palaeozoic oceans, and seems to have been closely linked to a pronounced increase of nutrient input to sea-surface waters during the Palaeozoic eutrophication episodes.
Discovery of gastropod-type nacre in fossil cephalopods: a tale of two crystallographic textures Frýda, Jiri *1, Rieder, Milan 2, Klementová, Mariana 2, Weitschat, Wolfgang 3 & Bandel, Klaus 3 1 Czech Geological Survey, 2 Institute of Geochemistry and Mineralogy, Charles University, Prague, Czech Republic; 3 Geologisch-Paläontologisches Institut und Museum, Universität Hamburg, Hamburg, Germany. Email: bellerophon@seznam.czCrystallographic textures and microstructures of molluscan shells may provide information of pivotal value for phylogenies. To fill a gap in our knowledge on the crystallographic textures of fossil molluscs, we have applied the X-ray oblique-texture diffraction to the examination of nacreous layers in fossil members of the classes Gastropoda and Cephalopoda. The nacre in living gastropods is demonstrated to be crystallographically uniform (preferred orientation of aragonite with [001]* as axis of the texture, and perpendicular directions [100]* and [010]* random). This crystallographic pattern remained unchanged for at least the last 200 Ma. Previous studies of nacre in living cephalopods (species of Nautilus) revealed a different crystallographic texture: perfect preferred orientation of all axes providing a single crystal-like X-ray pattern. This was interpreted as evidence for unrelated origin of nacre in the classes Gastropoda and Cephalopoda. Our data on fossil cephalopod nacre, however, contradicts that interpretation. We found gastropod-type nacre in Mesozoic members of suborders Ceratitina, Ammonitina, and Phylloceratina (order Ammonoidea). Thus the columnar nacre of gastropods and cephalopods may be homologous whereas Nautilus-type nacre may be an evolutionary novelty in the class Cephalopoda.
A revision of temperate Australian marine and brackish-water Assimineidae (Caenogastropoda: Rissooidea) Fukuda, Hiroshi1* and Ponder, Winston F.2 1. Conservation of Aquatic Biodiversity, Faculty of Agriculture, Okayama University, Japan. Email: suikei1@cc.okayama-u.ac.jp 2. Australian Museum, Colledge Street, Sydney, NSW 2010, Australia. Email winstonp@austmus.gov.au Assimineids occur worldwide in all temperate and tropical areas, with marine, estuarine, freshwater and terrestrial taxa. Their diversity is only becoming recognised. Members of the Assimineidae are common but rather inconspicuous members of the upper littoral in most parts of Australia, particularly in estuarine habitats. The Australian taxa have never been revised and the few named species are poorly resolved. We are describing members of the most conspicuous group of assimineids from temperate Australia based on the available material in museum collections and recent field work. This group has been treated as a single species until now. It was previously known as Assiminea buccinoides (Quoy and Gaimard, 1834) or A. tasmanica T. Woods, 1876. However, we have recognised four species (two new) and three new subspecies in the complex. Five taxa have rather narrow ranges while the other two are widespread and often sympatric. A new genus would be needed for the taxon previously known as Assiminea buccinoides. Assiminea affinis Böttger, 1887, a previously unrecognised Australian assimineid species, was confirmed to be allocated to the genus Taiwanassiminea Kuroda and Habe, 1950 from Taiwan. This is the first record of the genus from Australia. T. affinis is found in slightly brackish-waters in the upper tidal reaches of the larger rivers from northern Queensland to the Shoalhaven River, in the southern half of New South Wales. Furthermore, another new genus and species of the family was discovered from mangrove swamps in Queensland. It differs from other assimineid genera in several anatomical and radular characters, including an anterior pedal mucous gland composed of elongate cells arranged in transverse row unique for the subfamily Assimineinae and sole of the foot with distinct transverse rugae unique for the family. This species is also shown to be the first case of protandry in the family.
An investigation of the biochemical relationships associated with shell reduction and loss in opisthobranch molluscs Furuhashi*, Takeshi, Brooks, Peter, Brooker, Lesley & Duncan, Peter Faculty of Science, University of the Sunshine Coast, Maroochydore DC, Qld, Australia 4558. Email t_f002.@student.usc.edu.au Shell loss in molluscs is considered to be a recent evolutionary development, with the Opisthobranchia representing the full range of morphogenesis from obvious external shell to complete shell absence. The evolutionary progression from shell reduction to shell loss has been correlated with inhibition of the mineralzation process in shell formation. While it has been recognised that sugars play a principle role in biomineralization through the provision of nucleation sites for crystallization, the type and proportion of sugars involved in the process has not been investigated. This current study utilized the techniques of gas chromatography and colorimetric assay to analyse the ratio of N-acetylated amino sugars to D-mannose sugars, and the ratio of sulphated sugars to neutral sugars, respectively. The results indicate a positive relationship between low relative ratios of D-mannose sugars and progressive shell loss. This evolution of mucus sugars is hypothesized to be related to rapid growth in mollusc species, and is coincidental with the evolution of shell loss.
Larval development in Dermatobranchus sp. (Nudibranchia: Arminina) Furuhashi, Takeshi*, Cobb, Gary, Brooker, Lesley & Willan, Richard Faculty of Science, University of the Sunshine Coast, Maroochydore DC, Qld, Australia 4558. Email: t_f002.@student.usc.edu.au A new species of nudibranch, Dermatobranchus sp. (Nudibranchia: Arminina) produces a cylindrical, cord-like egg mass, with eggs approximately 100m in diameter. Within one week of spawning the eggs hatch into planktonic veliger larvae, which possess a spiral protoconch, typical of many nudibranch species. The larvae pass through three distinct stages of development prior to settling and metamorphosis into adults, which occurs 30 days after hatching. There is scant knowledge available on the embryology and larval development of Arminina, and this new species presents an opportunistic insight into ontological development within this order.
Zonation of scaphopod species in Cuabagua Island, Venezuela Galindo, Lee Ann*, Capelo, Juan Carlos, Hernández, Jesús, & Gómez, Alfredo Escuela de Ciencias Aplicadas del Mar, Núcleo Nueva Esparta, Universidad de Oriente. Apdo. 147. Boca del Río, Edo. Nueva Esparta, Venezuela. Email: lgalindo@ne.udo.edu.ve Cuabagua Island has represented a historical important place due to its foundation as the first city in South America during colony time. In 1541 a hurricane drawn it and since that event a relative early ecological succession has taken place. Although it constitutes a very diverse habitat, no attention has been taken either to the process or to the colonization by any specie. Our main propose is to describe all the molluscs that live into that area, however we are only presenting scaphopods faunal distribution as an advance of the research. The samples were taken in an area of 1m2, in two different depths (separated by 50 m of distance between them) perpendicularly from beach line, at stations located every 500 m around the island. The study corresponds to the west and north part of the island. A total of 59 scaphopods were found. There is a conspicuous zonation of these species in the area, revealing that none of the species found seems to be sympatric between them. Family Siphonodentallidae, represented by Polyschides tetraschistus (Watson, 1879) and Polyschides sp., was found only in northern Cubagua (37 organisms 62.61%) while F. Dentallidae, represented by Graptacme eboreum (Conrad, 1846) and Antallis sp., was registered in both sites (19 organisms 32.20%). A bionomic map of scaphopods is presented. Individuals were registered from 1 to 9 m of depth. Parches in two specific sites of the study area, happen to be the most frequently inhabit zone by scaphopods, presumedly for the food quality offered by the fine-grained sediments.
Effects of clam dredging on consolidated grounds and subsequent recovery of benthic habitat off the Portuguese southern coast Gaspar1*, M.B., Regala1, J.T., Constantino1, R., Cúrdia1, J., Carvalho1, S., Chícharo2, L.M., & Monteiro1, C.C. 1 Instituto Nacional de Investigação Agrária e das Pescas (INIAP/IPIMAR), Centro Regional de Investigação Pesqueira do Sul (CRIPSul), Avenida 5 de Outubro s/n, P-8700-305 Olhão, Portugal. *Email: mbgaspar@ipimar.ualg.pt2 Universidade do Algarve (UAlg), Faculdade de Ciências do Mar e do Ambiente (FCMA), Campus de Gambelas; P-8000-810 Faro, Portugal
Several studies showed that bottom mobile fishing gears have a deleterious effect on the environment. The ecological effects of clam dredging can be short-termed or lead to long-term changes in community structure, depending on several factors, such as depth, sediment type and hydrodynamics. Sometimes it is difficult to distinguish between fishery driven changes in community structure and those caused by natural phenomena. Therefore, it is of utmost importance to evaluate the ecological relevance of fishing disturbance versus natural perturbation. In this context a study was undertaken aiming (1) to analyse the immediate environmental effects of Portuguese clam-dredge fishery on benthic communities, (2) to monitor its subsequent recovery and (3) to evaluate the changes in community structure due to natural perturbation. Hence, a summer to fall sampling program was undertaken during 2003. Two 2500 m2 areas each, at 20 metres depth, were subjected to different stress levels, considering sporadic fishery (experimental area) and no fishery (control area). In the experimental area, fishing stress was simulated following usual commercial fishing procedures, thus dredging an area for an hour using two clam-dredges simultaneously. In each area, benthic macrofauna and meiofauna samples were collected by divers periodically (before dredging, immediately after and on the ensuing 24h, 48h, 120h and 13, 35 and 90 days). All sampling was performed with adequately replicated corer collection, using 64cm2 corers for macrofauna and 20 cm2 for meiofauna, buried 15cm and 10cm, respectively. Oceanographic parameters were also registered during the sampling period. Considerably minor dredge fishery driven effects and fast recovery of the benthic communities are highlighted in opposition to some degree of natural variation. The present poster summarily describes the preliminary results of the Project DREDGIMPACT (POCTI/ MGS/ 42319/ 2001), which is funded by the "Fundação para a Ciência e Tecnologia" (FCT).
Which are the benefits of using more selective and efficient bivalve dredges? Gaspar1*, M.B., Leitão1, F.M., Santos1, M.N., Chícharo2, L.M., Chícharo2, A. & Monteiro1, C.C. 1 Instituto Nacional de Investigação Agrária e das Pescas (INIAP/IPIMAR), Centro Regional de Investigação Pesqueira do Sul, Av. 5 de Outubro s/n, 8700-305 Olhão Portugal. Email: mbgaspar@ipimar.ualg.pt2 Universidade do Algarve (UAlg), Faculdade de Ciências do Mar e do Ambiente (FCMA), Centro de Ciências do Mar (CCMAR), Campus de Gambelas;8000-810 Faro; Portugal
Clam and razor clam mechanical dredges are extensively used along the Portuguese coast. These fishing gears are composed by a rigid iron structure with a toothed lower bar that can penetrate into the sediment up to 50 cm, depending on target species and sediment type. These dredges dig bivalves out of the sediment, impacting the benthic habitat, both in terms of its physical structure (smoothing sedimentary bedforms, reducing bottom roughness and re-suspending the sediment) and its biological communities (destruction of the benthos and loss of biodiversity). Apart from landings, dredging also causes other kind of mortality, either directly or indirectly. In the case of the infauna, if individuals are retained for a long time in the net bag, the stress to which they are submitted increases. As a consequence, the undamaged individuals that escape through the net bag do not bury themselves immediately, being more vulnerable to predation. Furthermore, low selective fishing gears lead to large amounts of by-catch. It is known that for some species survival of undamaged discarded individuals is directly related to the time of aerial exposure on deck. Individuals returned to the seabed, will provide potential food for scavengers and predators. Therefore, their survival depends on the time needed to rebury (in the case of infauna) or to restart their normal activity (in the case of epifauna). Since the Portuguese bivalve fishery is managed by daily quotas per boat, the higher the catching efficiency of the fishing gear the lower the fishing area needed to achieve the quota. Taking into consideration all the above considerations, a new bivalve dredge was developed, which is more selective and efficient than the traditional ones. In this presentation we will show how gear modifications became effective in reducing the environmental impact of dredging.
Vetigastropod evolution: Summary of knowledge, insights from Scissurellidae, macroevolutionary prospects. Geiger, Daniel L. Santa Barbara Museum of Natural History, 2559 Puesta del Sol Road, Santa Barbara, CA 93105, USA. Email: geiger@vetigastropoda.com Vetigastropoda is an ancient group of mollusks, previously part of the Thiele's Archaeogastropoda, now recognized with the gill bursicles as its diagnosing character. Various phylogenies are surveyed; all strongly disagree with one another. One problem may be the incomplete taxon sampling with a negative bias against small sized groups, or a positive bias for hydrothermal vent taxa to the exclusion of shallow water clades. Some new data for the least studied "Scissurellidae" is presented. Protoconch sculpture shows further intrageneric variability. Bursicles are confirmed in Sinezona rimuloides and Anatoma euglypta. Eyes are confirmed for Anatoma. Molecular data show "Scissurellidae" to be polyphyletic: Anatominae plus Scissurellinae is not monophyletic. Radular patterns supposedly diagnostic for families have to be re-evaluated. The rhipidoglossate radula with a serrated rachidian of Scissurellidae is most likely close to the plesiomorphic condition in Vetigastropoda, with the radular types of large-bodied families (Haliotidae, Fissurellidae) being derived by peramorphy. The monophyly of Trochoidea should be re-assessed as the diagnostic characters (absence of slit, reduction of right gill and associated organs) are reductive in nature. Tricolia is most likely not a trochoidean, and has been placed as sistergroup to Fissurellidae towards the base of Vetigastropoda; whether Phasianella and Tricolia are monophyletic is uncertain. Some cursory observations are presented. Gonad reduction in Sinezona shows a single row of eggs, and is strikingly parallel to the arrangement in the smallest fish, the gobiid Schindleria. Sectioning of some scissurellids suggests a biased sex ratio with excess females, though in the most thoroughly studied abalone, no such bias has been found. The vertical colonization pattern of the ocean is currently being investigated using Vetigastropoda. The onshore-offshore pattern is confirmed particularly by the polyphyletic Scissurellidae, and colonization of vents seems to be stochastic. Shell reduction in Fissurellidae has been overlooked. Much anatomical data remains to be gathered.
Molluscan remains from archaeological sites on the north coast of New Guinea Gerber Jochen 1* & Schechter Esther 2 1. Department of Zoology (Invertebrates), Field Museum of Natural History, 1400 S. Lake Shore Drive, Chicago, IL 60605-2496, USA. Email: jgerber@fieldmuseum.org. 2. Department of Anthropology, Field Museum of Natural History In 1996, anthropologists of the Field Museum and the Papua New Guinea National Museum conducted the first archaeological excavations in the Aitape District of NW Papua New Guinea. Test excavations of ancient settlements took place at two sites in the Aitape hills, ca. 2 km inland from the coast, and on Tumleo Island, ca. 2 km off the Aitape coast. Shells excavated at the Aitape hill sites were radiocarbon-dated to ca. 1280-1330 years b.p. At the two hill sites and on Tumleo Island remains of at least 42 marine, 15 fresh/brackish water and 10 terrestrial mollusk species were recovered. The shells from the Aitape hill sites were analyzed quantitatively. Although more than twice as many marine than freshwater species were found, 83% of the 3,600+ specimens belonged to fresh/brackish water taxa, predominantly of the genera Melanoides, Faunus, Batissa and Geloina. Obviously the inhabitants of the hills gathered shellfish mainly in the surrounding rivers, estuaries and brackish lagoons. Marine mollusks were of inferior significance in their diet. Most marine species are represented by 1-10 specimens only, while only two species (Anadara granosa, Donax cuneatus) account for 76% of all marine specimens. Marine shells were also used as ornaments and tools. Of the shells excavated on Tumleo Island only a qualitative assessment of the species composition was carried out so far. Here fresh/brackish water species are fewer and restricted to the genera Faunus, Batissa and Geloina which are frequenly found in brackish, estuarine habitats; Melanoides species and other freshwater dwellers found further upstream are lacking. Marine mollusks likely played a bigger role in the diet of the ancient people of Tumleo than of those in the inland hills.
Effect of the pollutants lead, zinc, hexadecane and octocosane on total and shell growth in the akoya pearl oyster, Pinctada imbricata Gifford, Scott P.*1, Macfarlane, Geoff R.1, O’Connor, Wayne A.2, Dunstan, R. Hugh 1 1. School of Environmental and Life Sciences, University of Newcastle, Newcastle, Australia 2308. Email: Scott.gifford@studentmail.newcastle.edu.au 2. NSW Fisheries, Port Stephens Fisheries Centre, Taylors Beach, Australia, Private Bag 1 Nelson Bay, NSW, Australia 2315
Pearl aquaculture has recently been proposed as a coastal environmental remediation tool. Oysters are used to filter the water column, concentrating nutrients and pollutants within their shell and tissue that are removed from coastal waters on oyster harvest, while at the same time forming a new pearl. This technology will be limited by the tolerance of the oysters to various pollutants. In this study, Akoya pearl oysters (Pinctada imbricata) were held in the laboratory and exposed to various levels of the heavy metal pollutants lead and zinc and the aliphatic hydrocarbons hexadecane and octacosane for two (2) months. Individual oysters were followed over the course of the experiment, allowing specific calculation of both total oyster growth (wet weight) and shell growth. Significant reductions in total oyster growth were observed when oysters were exposed to both high concentrations (270µg L-1) of zinc and lead. Exposure to the aliphatic hydrocarbons had no effect on total oyster growth. High concentrations of lead halted shell biomineralisation, the first demonstration of pollutant induced cessation of biomineralisation in pearl oysters.
Figure: Oysters cultured under different concentrations of lead; background + a) 10 µg L-1 b) 30 µg L-1 c) 90 µg L-1 and d) 270 µg L-1. Note the absence of imbricate processes around the shell margins for the oysters cultured under 90 and 270 µg L-1. It is proposed that biomineralisation may be impeded by lead interference with carbonic anhydrase, an enzyme essential for both shell and pearl production in pearl oysters. The results from this study do, however, indicate that P. imbricata is relatively tolerant of pollutants, and could be deployed within a remediative context in moderately polluted coastal areas. The evolution and phylogeny of the Bivalvia Giribet, Gonzalo Department of Organismic & Evolutionary Biology, Museum of Comparative Zoology, Harvard University, 16 Divinity Avenue, Cambridge, MA 02138, USA Email: ggiribet@oeb.harvard.edu Interest in the field of bivalve phylogeny and evolution has increased remarkably in recent times, especially since the incorporation of molecular data into the toolkit of evolutionary biologists. Bivalves have emerged as fascinating models for testing the phylogenetic power of molecular data, multiple colonizations of freshwater environments, colonization of deep-sea environments, larval evolution, and for the study of chemoautotrophic endosymbioses, symbioses with zooxanthellae, and many other interesting topics in evolutionary biology. Though bivalves are, for the most part, inconspicuous creatures, they have proven to be far more fascinating, and their history more perplexing, than their simple appearances would suggest. To better understand these enigmatic creatures, and the interesting biological questions that surround them, we must continue to reveal the patterns of their evolutionary tree. In order to do so, I have investigated relationships among all bivalve superfamilies (and ca. 60% families) by using morphology and molecular sequence data of four markers, two nuclear ribosomal genes, one nuclear coding gene (histone H3), and one mitochondrial coding gene (cytochrome c oxidase subunit I). The data have been analyzed in a sensitivity analysis framework by exploring multiple combinations of parameter sets in order to test for phylogenetic stability. Direct optimization (parsimony-based) of all data analyzed simultaneously has been chosen as the preferred method of analysis. Results show some level of disagreement between the morphological and molecular data, but combined analyses of all data yield stable topologies and show paraphyly of the protobranchiate bivalves, but monophyly of Autolamellibranchiata, Pteriomorphia, Heteroconchia, Palaeoheterodonta, and Heterodonta. Evolutionary history of Heterodonta is especially interesting because it includes the old "subclass" Anomalodesmata, and neither Veneroida nor Myoida are monophyletic groups, therefore urging taxonomical revision. Carditoidea + Crassatelloidea constitutes the sister group of the remaining heterodonts.
Phylogenetic relationships of the molluscan classes
Giribet, Gonzalo1, Okusu, Akiko1, Lindgren, Annie R.2, Huff, Stephanie W.1 & Nishiguchi Michele K.2 1 Department of Organismic & Evolutionary Biology, Museum of Comparative Zoology, Harvard University, 16 Divinity Avenue, Cambridge, MA 02138, USA2 Department of Biology, New Mexico State University, Box 30001, MSC 3AF, Las Cruces, NM, 88003-8001, USAOne of the hardest evolutionary enterprises has been producing a robust and stable phylogeny of all the deepest branches within the Mollusca, the animal phylum with the largest body plan disparity (and second in described species diversity). The first problem is to solve the question on whether molluscs are monophyletic or not. For example, molluscan monophyly has remained pervasive to molecular analyses while the same loci are able to recover monophyly of other megadiverse animal phyla such as arthropods and nematodes. If molluscs are monophylyetic, their exact position within the spiralian protostome worms is still highly debated; if molluscs are polyphyletic, the relationships of their putative lineages are even more controversial. In this study we revise the molluscan literature with respect to their position in the animal kingdom and the molecular and morphological studies. With the analysis of novel molecular data from 5 loci for 110 molluscan species representing most molluscan higher lineages (with the exception of Monoplacophora) plus 23 outgroup taxa including mostly protostome spiralians and the enigmatic Xenoturbellida we present the limitations of the current data and analytical methods. In this talk we discuss potential issues on studying deep divergences among molluscs and propose strategies for future work on molluscan phylogenetics.
Mushroom corals and associated gastropods: phylogenies and distributions Gittenberger, Adriaan*, Gittenberger, Edmund, & Hoeksema, Bert W. National Museum of Natural History Naturalis, P.O. Box 9517, 2300 RA Leiden, The Netherlands. Email: Gittenberger@naturalis.nnm.nl Corals and other sessile invertebrates are known to harbour various symbionts. Host-parasite associations are therefore important in evolutionary studies related to species diversity. Mushroom corals (Fungiidae) and their parasitic snails (Epitoniidae and Leptoconchus spp.) are ideal model taxa to study such aspects. A morphology-based phylogeny reconstruction of the Fungiidae is available, but such data are lacking for their gastropod parasites. Here we use DNA-sequencing to obtain reliable phylogenies for both the coral and the snail taxa. For that purpose, the snails and their hosts were collected at various Indo-Pacific localities, i.e., in Indonesia, Philippines, Egypt, and Palau. While doing so, the habitats of the snail species at various localities were also studied. The DNA-analyses showed that there are far more separate gene-pools among the gastropods than had been distinguished as species on the basis of only morphology. This was most obvious in Leptoconchus, where the snails live inside the host corals and do not show much interspecific differences, if any, in shell morphology. Hence, these species are difficult to distinguish. Nevertheless, their conchological characters were used in the literature to characterize 9 "morpho-species" (Massin, 2003). However, the molecular data on Leptoconchus, i.e. about 150 sequences of CO-1, ITS-1 and ITS-2, indicate that there are at least 18 species, each of which restricted to its own host coral species. A similar pattern was found for wentletraps (Epitoniidae), which are associated with mushroom corals. On the basis of morphological studies 6 species were recognized (Gittenberger et al., 2000), but a molecular analysis, i.e. c. 200 sequences of CO-1 and ITS-1, suggests that there are at least 12 species, each associated with its own hosts. Both morphological data and the DNA-analyses indicate that several species have large ranges, being distributed from the Red Sea and the Indian Ocean to the Pacific Ocean.
Snails in space: The amazing wanderings of the Balea species Gittenberger, Edmund1*, Groenenberg,Dick1, Kokshoorn, Bas1, & Preece Richard C. 2 1. National Museum of Natural History Naturalis, P.O. Box 9517, 2300 RA Leiden, The Netherlands. Email: gittenberger@naturalis.nnm.nl 2. Department of Zoology, University of Cambridge, Downing Street, Cambridge CB2 3EJ, UK Balea perversa is a widespread pulmonate snail species, reported from Europe, Iceland, Madeira and (incorrectly as we now know) the Azores. Another species, B. nitida, is considered an endemic from the Azores. Recently it became known that several additional Balea species occur far south in the Atlantic, in the Tristan-Gough archipelago. Apart from that, a second Balea species, B. heydeni, was re-discovered in western Europe and the Azores, where it had been confused with B. perversa. Molecular studies on material from Europe, Iceland, the Azores and the Tristan-Gough archipelago have confirmed these views, that were initially based on shell morphology and anatomical data only. Additionally this work has shed some light upon the unusual historical biogeography of the genus Balea.
A new look at old lineages: riverine ancestry and the origin of adaptive radiations in limnic gastropods Glaubrecht, Matthias Museum of Natural History, Humboldt University, Institute of Systematic Zoology, Invalidenstrasse 43, D-10115 Berlin, Germany. Email: matthias.glaubrecht@rz.hu-berlin.de
Earlier attempts to evaluate factors responsible in these radiations suffered from lacking insight into the morphology of the constituent taxa as well as into the systematics and phylogeny of these limnic Cerithioidean gastropods in general. In Lake Tanganyika, for example, the origin of its thalassoid (i.e. marine-like) gastropod radiation long remained enigmatic. In contrast to former studies that assumed an in situ radiation within Lake Tanganyika and hypothesized the riverine genus Potadomoides from the Congo River drainage as ancestral to the entire Tanganyikan radiation, it will be shown here based on morphological and molecular phylogenetic evidence both from the lake radiation and a study of the riverine taxa that (i) Lake Tanganyika provides an evolutionary reservoir for old (riverine) lineages, and that (ii) the uterine brooder Potadomoides represents the adelphotaxon to Lavigeria only, but not to the entire thalassoid species flock. Evolutionary and taxonomic implications are discussed, and are compared with riverine radiations among pachychilids in Australasia. We report an exceptional endemic assemblage of morphologically distinct viviparous species in Brotia found within the Kaek River, Thailand, with syntopic occurrence of up to three species ecologically separated by habitat preferences and trophic specializations. Based on a molecular phylogeography the origin from a Mekong River ancestor is hypothesized, and evolutionary aspects are discussed in light of riverine "radiations" and lacustrine species flocks found also in the closely related Tylomelania endemic to Sulawesi.
Phylogeny and phylogeography of Neotrigonia (Bivalvia: Palaeoheterodonta)
Glavinic, Ana Flinders University of South Australia, GPO Box 2100, Adelaide, SA 5001, Australia. Email: ana.glavinic@flinders.edu.au
Two contrasting phylogenies , based on morphology and molecular data of the higher level relationships within the Bivalvia have recently been proposed. The major point of disagreement between the two phylogenies is the placement of the Trigonioida. Neotrigonia species represent a relict lineage of the bivalve order Trigonioida. Until the early eighteen-century naturalists believed that the family, to which it belongs, the Trigoniidae was extinct. The extant seven species, recognized today are restricted to Australian, Papua New Guinean and New Zealand waters. The representatives of the single extant genus Neotrigonia have a mixture of seemingly primitive features such as filibranchous gills possessing ciliary-linked gill filaments, lack of posterior mantle fusion and nacreous shells with derived features, such as a multi-vesicular sperm acrosome. The combination of primitive and derived character states has contributed to the development of multiple hypotheses of Trigonioidae evolutionary affinities. The proposed research aims to resolve the phylogeny and phylogeography of Neotrigonia and its phylogenetic position within the Bivalvia.The primary objectives are to combine molecular, morphological and fossil data, which surprisingly has not been attempted for this group before. Preliminary molecular analysis has been performed on two living populations of Neotrigonia spp. Population from Port Philip Bay, Victoria, is currently identified as Neotrigonia margaritacea, and population from Port Stanvac, South Australia, as Neotrigonia bendalli. The analysis of mitochondrial DNA, gene CO-I, where sequences were 600 base pairs long shows these two populations to be identical. Further research will result in more information about general biology, ontogeny and behavioral patterns of the genus.
The new Lucinoidea - major clades Glover, Emily A.* and Taylor, John D. Department of Zoology, The Natural History Museum, London SW7 5BD, United Kingdom. Email: emily.glover@dial.pipex.com Out of the seven bivalve groups with chemosymbiosis Lucinoidea sensu stricto are the most diverse, with an estimated 85 described or recognised living genera and around 500 extant species. They live in an extremely wide range of habitats, from the intertidal to the deep sea, occupying coral sands, mangroves, muds, seagrass beds, sites of high organic enrichment and cold seeps. Previous phylogenetic analyses, based entirely on shell characters, are incongruent with a new molecular analysis, using 18s and 28s genes. Within the new Lucinoidea, now restricted to the families Lucinidae and Fimbriidae, six major clades have been identified; these are informally named the Anodontia group, the Myrtea group, the Fimbria group, Phacoides group, lucinid group A and lucinid group B. Anodontia species, for example, form a highly supported clade that is distant from other lucines; their genetic distance is corroborated by morphological apomorphies, including the presence of a mantle septum, the form of mantle gills, the highly fused posterior mantle and the edentulous, thin, inflated shell. Morphological characters, such as the mantle gills, the length of mantle fusion and form of posterior apertures have potential as discriminatory characters in phylogenetic analysis. This initial and preliminary analysis of relationships within the Lucinoidea is presently being extended to include more taxa, additional genes and new morphological characters. New discoveries continue, especially from deeper water; we have just described the first lucinid from a 500m hydrothermal vent on the active volcanic arc of the Kermadec Ridge, New Zealand. Interestingly, morphological and molecular evidence suggests that this lucinid is allied to an intertidal, mangrove genus, Austriella, from the tropical Indo-Pacific.
Morphological studies of Australian Amphibolidae (Gastropoda: Pulmonata) Golding, R. Department of Anatomy and Histology, University of Sydney, Sydney 2006, New South Wales and Australian Museum, 6 College Street, Sydney, NSW 2010, Australia. Email: rgol8300@anatomy.usyd.edu.au The morphology of two Australian species of the intertidal marine pulmonate family Amphibolidae is described. The anatomy of Salinator solida and Salinator fragilis are discussed, with comparison to the type species of the family, the New Zealand Amphibola crenata. Although the shell, opercular and external morphology of both Salinator species show some similarities, aspects of the reproductive anatomy of these species were substantially different. The configuration of the terminal genital apparatus of S. fragilis was found to be monaulic, as in A. crenata, with an undivided hermaphrodite duct and a single structure (possibly a combined penis/ovipositor) at the genital aperture. The gonoduct of S. solida diverges, with a separate muscular vagina and an unusual male copulatory organ uniting at a single genital aperture. Scanning electron micrographs of radulae from S. fragilis, S. solida and A. crenata also provide evidence of divergence between the species, both within and between the current generic concepts. Plesiomorphic pallial structures include a pair of opposed ciliated bands found in A. crenata and S. fragilis, but these are absent in S. solida. The substantial anatomical differences observed between the two Australian amphibolids suggest that a separate genus should be created to include S. solida. Work is continuing on the morphology and histology of these animals.
Recent advances in the systematics and phylogeny of goniodorid nudibranchs Gosliner, Terrence M. California Academy of Sciences, 875 Howard Street, San Francisco, CA 94103 USA Recent studies focusing upon the Indo-Pacific and eastern Pacific species of Okenia, demonstrate previously undocumented diversity. Ten new and recently described species provide a basis for review of phylogenetic relationships within goniodorids. Morphological variation, particularly of radular tooth shape, is diverse within the members of the genera traditionally placed within Okenia, Hopkinsia, Hopkinsiella and Sakishimaia. These studies suggest the monophyly of Okenia, but demonstrate the paraphyly of Hopkinsia, Hopkinsiella and Sakishimaia. Based on these studies nomenclatural changes are proposed. New Indo-Pacific and eastern Pacific taxa are situated within several distinct lineages, suggesting considerable radiation within these geographic areas. Sister-group relationships are examined to suggest isolating mechanisms leading to distinct geographical speciation patterns. These vicariant patterns are compared with those present in other opisthobranch taxa.
Genetic variability and phylogeographical patterns of the invasive species Dreissena polymorpha Gosling, Elizabeth Molecular Ecology Research Group, Galway-Mayo Institute of Technology, School of Science, Galway, Ireland. elizabeth.gosling@gmit.ie Dreissena polymorpha (Pallas) is an invasive mussel indigenous to the Caspian Sea, but has spread throughout most of Europe and eastern North America. The mussel was first reported in Ireland in the lower Shannon system in 1997, but was probably introduced in 1994 or even earlier. The zebra mussel has spread rapidly up the Shannon system and its connecting canals. The source population(s) of Irish zebra mussels is at present unknown. Ten selected populations from Ireland (Limerick, Lough Derg, Lough Key, Assaroe, Dublin), England (London Docks), Holland (Meuse River), Romania (Prut River) and N. America (Lake Ontario and Lake St. Claire) were tested for genetic heterogeneity at five trinucleotide microsatellite loci. Heterozygosity levels observed in Irish populations were well within the range obtained for European and Great Lakes populations, suggesting that the Irish founder population(s) were large, or that there were several introductions after foundation. Significant heterozygote deficiencies were observed at all five loci, which could be interpreted as evidence for population subdivision and local inbreeding within populations. Tests for linkage disequilibrium failed to show significant disequilibria between any microsatellite locus pair. Comparisons between Irish, European and North American populations indicated little differentiation between Irish and English populations, most likely reflecting an English origin for Irish zebra mussels. The clustering of Lake St. Claire, where zebra mussels were first reported in North America, with the sample from the Netherlands suggests a potential founding population from North-West Europe, rather than from Central Europe. The Romanian population (considered to be a native site for zebra mussels), while divergent from all locations, was closer to Lake Ontario than to any other population.
Palaeoheterodont diversity: What we know and what we wish we knew about freshwater mussel evolution Graf, Daniel L1* and Cummings, Kevin S.2 The Academy of Natural Sciences, Philadelphia, Pennsylvania 19103 U.S.A. Email: graf@acnatsci.org Illinois Natural History Survey, Champaign, Illinois 61820 U.S.A. "When you know a thing, to hold that you know it; and when you do not know a thing, to allow that you do not know it — this is knowledge." Confucius The Palaeoheterodonta is a diverse clade consisting of the freshwater bivalve order Unionoida and its marine sister group, Neotrigonia. Neotrigonia is the sole surviving member of Trigonioida, known today from only 6 species restricted to Australian waters. Unionoids (also known as freshwater mussels), on the other hand, are widely distributed on all continents except Antarctica, and are represented by nearly 900 species divided among 6 families. Discussions of palaeoheterodont diversity are numerically biased towards the freshwater mussel condition, but Neotrigonia is crucial as a ‘living fossil’ for establishing the plesiomorphic states for characters crucial to unionoid systematics. In fact, based on recent cladistic studies, Neotrigonia appears to retain many of the characters of the ancestral heteroconch. Based upon recent cladistic studies of both molecular and morphological data, we present a summary phylogeny of freshwater mussels emphasizing synapomorphies and sister-relationships. The Unionoida is monophyletic based upon several synapomorphies, including presence of parasitic larvae, parental care (i.e., brooding) and restriction to freshwater. The order is composed of six families divided between two superfamilies, Unionoidea and Etherioidea: ((Unionidae, Margaritiferidae), (Hyriidae, (Iridinidae, (Mycetopodidae, Etheriidae)))). This family-level phylogeny deviates from the one traditionally preferred but is supported by most cladistic analyses. The synapomorphies of these taxa, as well as problematic genera, are discussed. Understanding the current, global diversity of the Unionoida is complicated by the absence of cosmopolitan treatments of freshwater mussel genus- and species-level assessments. Based upon our own syntheses of numerous provincial studies of freshwater mussel taxonomy, analyses of unionoid diversity in space and time are discussed with twin goals of synthesis and highlighting outstanding problems.
Influence of conditioning diet and spawning frequency on variation in egg diameter for greenlip abalone, Haliotis laevigata. Graham, Fiona*, Mackrill, Tahryn & Daume, Sabine Research Division, Department of Fisheries, P.O. Box 20, North Beach, WA 6920, Australia Abalone larvae are lecithotrophic and thus rely heavily on yolk reserves provided by the egg to fuel development. Previous work indicated that smaller eggs hatched better and contained more total lipid. Both egg provisioning and egg diameter are therefore important factors governing the development and survival of larvae. The diet of female broodstock and the conditioning regime are likely to contribute to the quality of abalone eggs. In this study we examine the effect of four broodstock diets (three formulated diets differing in fatty acid composition and a red seaweed control) and conditioning regime on egg diameter variability within a batch spawned from one female and between batches. Abalone broodstock were spawned at the beginning of the experiment and again after 16 and 32 weeks using commercial hatchery practices. Eggs obtained from individual females were measured prior to fertilisation. Cytoplasm diameter, vitelline layer and jelly coat thickness were compared between eggs spawned from individual females and between females. The variability of egg diameter within batches spawned from the same female over two spawning rounds and within diet treatments were determined. Egg diameter variability appears to be driven primarily by the individual female rather than by diet treatments or spawning frequency. Batches spawned from the same female abalone became more variable over time with a shift in size frequency distribution. In addition the relationships between broodstock parameters (weight and shell lengths) and batch size (number of eggs spawned by one female) as well as egg diameter were explored. We found a significant correlation between batch size and egg diameter. No relationship between batch size or egg diameter and broodstock parameters was found. Results indicate that the variability of egg diameter within a batch changes from female to female and highlights the importance of selecting successful broodstock for conditioning at commercial hatcheries.
The present condition of najad populations in the Grand Duchy of Luxemburg Groh, Klaus1 & Weitmann, Gerhard2 1. Mainzer Str. 25, D-55546 Hackenheim, Germany. Email: klaus.groh@conchbooks.de 2. Im Eisel 13, D-55411 Bingen, Germany. Email: weitmann.gerhard@t-online.de During the years 2001 to 2003 fieldwork was carried out to check the present condition of large freshwater mussels (najads) in the Grand Duchy of Luxemburg. Based on the data from the literature, collections, unpublished data of investigations in the 1970ies, and our country-wide collections in 1997 to 2000 previously known and newly found collecting-sites of najads were reinvestigated to check the present condition of the populations. As a result, in Luxemburg the previous or present existence of 7 species, the entire potential of the Mid-European najad fauna, could be confirmed: Margaritiferidae: Margaritifera margaritifera; Unionidae: Unio pictorum, U. tumidus, U. crassus, Anodonta anatina, A. cygnea and Pseudanodonta complanata. Their present condition in Luxemburg is as follows: Margaritifera m. margaritifera: Formerly known to occur frequently in several rivers and creeks of the North of Luxemburg (Öesling) the rivers Haute Sûre, Wiltz, Woltz, Clerve, Troine and Our have been investigated. Actually only one population survives in the Our. It is dominated by aged individuals. Even though there has been an annual artificial introduction of 10,000 brown trout with glochidia since 1990, there is only a small percentage of young mussels (less than 1% p.a.). This is the biggest of very few surviving populations of the Rhine-catchment. In the most other rivers populations of the species are extinct. Unio crassus riparius: This formerly common and wide-spread species was known from many running waters throughout the country. Sixty-nine track lines in 16 creeks and rivers were investigated. Only 4 empty shells proved its previous occurrence but 2 rivers still house large and reproductive populations of international importance: Our >6,000 specimens; Haute Sûre: ca. 60,000 specimens. Unio pictorum deshayesi: Restricted to larger rivers and creeks, the species was formerly widespread throughout Luxemburg. Populations survive in the Moselle and near the mouth of the Sûre only. An invasion of another race of U. pictorum competes successfully with the autochthonous population. Unio tumidus depressus: In the past known from the Bas Sûre and Moselle it appears to be extinct in Luxemburg. Perhaps a very few specimen survive in short tracks of the dammed Moselle, but this has yet to be demonstrated. Anodonta anatina avonensis: While in the past this species was not as common and widespread in Luxemburg as in southern and eastern bordering countries, it is now the most frequent najad. Even so, its distribution is still shrinking outside the dammed rives and, like U. pictorum, a newly invaded race competes successfully with autochtonous populations. Anodonta cygnea stagnalis: The more sensitive of the two Anodonta’s was always rare in Luxemburg, with small, very local populations. It is known only from 2 rivers and one pond. It co-existed in the pond with a population of A. c. cellensis, which unfortunately became extinct within the last 5 years. Pseudanodonta complanata elongata: This larger river inhabiting species was known only from one finding in the Moselle in the 1960s, As no material was preserved the occurrence was regarded as doubtful. Recent findings of a subrecent double-shell could prove the previous existence in Luxemburg, but the species is now extinct in waters of the Grand Duchy. Thus of 7 najads previously known to occur in Luxemburg only 5 survive in the 21st century. The populations of M. margaritifera and U. crassus, while highly endangered, are still of international importance and urgently need help by biotope-management and eventually breeding-programs. The autochtonous populations of two species (U. pictorum, A. anatina) are struggling against invading races and the last (A. cygnea) has survived only in a very few populations are highly endangered due to their sensitivity to water pollution. Supported by the Ministry of Environment and the Ministry of Interior of Luxemburg, represented by the "Service de la Chasse et Pêche", "Service de la Gestion de l’Eau" and the Ministry of Culture, represented by the "Musée nationale d’Histoire naturelle Luxembourg"
Preliminary list of the burrowing mollusks of Margarita Island, Venezuela Grune, Sylvia Universidad de Oriente Núcleo Nueva Esparta, Escuela de Ciencias Aplicadas del Mar, Department of Aquaculture, Boca del Rio, Isla de Margarita. Email: sylvia_grune@yahoo.com.mx The abundance and distribution of the burrowing mollusks were studied at the coast of the Margarita Island. Thirty two localities were sampled during march 2003 and june 2004. The sites were selected on the basis of dominant substrate diversity. 17 species were registered , six of these could only identify to the level of genus (Bankia sp1, Bankia sp2, Cyrtopleura costata (Linné,1758, ),Gastrochaena hians(Gmelin,1791), Gastrochaena ovata Sowerby, 1834; Gregariella coralliophaga (Gmelin,1791), Lithophaga antillarum (d´Orbingy, 1842; Lithophaga (Myoforceps) aristata ( Dilwyn,1817), Lithophaga bisulcata (d´Orbigny,1842), Lithophaga sp; Martesia cuneiformis (Say,1822), Martesia striata (Linne,1758), Martesia sp, Neoteredo sp, Pholas campechensis Gmelin,1790 Rupellaria typica (Jonas,1844 and Teredo bartschi Clapp, 1923 ). The most abundant species were Martesia striata (Linne, 1758), Lithophaga aristata (Dilwyn, 1817), Rupellaria typica (Jonas, 1844).and Gastrochaena ovata Sowerby, 1834. In terms of substrate preference, individual of the genus Lithophaga were found in the majority of the substrates with the exception of wood. Species of the genus Bankia , Martesia ,Teredo and Neoteredo showed preference for all kind of wood substrate. The western and north of the Island show low Diversity and Richness. The species Gastrochaena hians (Gmelin, 1791) is probably a new registration for the Western region of Venezuela. We concluded that the abundance and diversity of these animals were determinate by the diversity of substrate.
Growth in recovering beds of Tasmanian commercial scallops (Pecten fumatus) Haddon, Malcolm*, Semmens, Jayson, and Julian Harrington Marine Research Laboratory, Tasmanian Aquaculture and Fisheries Institute, University of Tasmania, Nubeena Crescent, Taroona, TAS 7053, Australia. Email: mhaddon@utas.edu.au The Bass Strait scallop fishery collapsed so that a stratified random dredge survey in 2000 found only one very small concentration of commercial scallops (Pecten fumatus) across the traditional scallop grounds in Commonwealth waters to the northeast of Flinders Island Tasmania. Annual surveys since then have followed the recovery of various scallop beds. It has been possible to follow the fate of known age cohorts of scallops across an array of different density beds in different geographical areas. The growth of the animals in these beds has been formally described and compared. Variation with respect to depth and latitude is described. Video footage of different scallop beds is used to illustrate the range of habitats. In general, it takes approximately 3+ years for Tasmanian scallops to grow to 90 mm shell length in the Bass Strait region.
Moving towards perfection? Locomotion of large slugs including the hybrid Arion ater x
A. lusitanicus Hagnell, Jan1, Schander, Christoffer1,2 & von Proschwitz, Ted3
Hancock, Boze*1,2, Basham, Candice3, & Friedman, Kim4 1. Western Australian Marine Research Laboratories, PO Box 20 North Beach, Western Australia, Australia, 6920. Email: bozehanc@cox.net 2. School of Animal Biology, University of Western Australia, 35 Stirling Hwy, Crawley Western Australia, Australia, 6009 3. 6A Grange St. Claremont, Western Australia, 6010 4. Secrétariat de la Communauté du Pacifique (CPS), Secretariat of the Pacific Community (SPC), BP D5 - 98848 NOUMEA CEDEX, Nouvelle-Calédonie
Recreational fishing for Roe’s abalone is carried out while wading or snorkeling in high density (30-90 legal size animals per m2) populations on reef platforms and sub-tidal reefs using a screwdriver or similar implement to lever abalone from the reef. This fishing technique coupled with the high stock density results in two presently unquantified sources of incidental mortality. Firstly, some fishers ‘high-grade’ their catch, selecting the largest from many, and discard the rest; secondly, inexpert use of the lever commonly results in injury to the foot of the abalone. Two methods were used to estimate incidental mortality from three discreet areas (600, 713, and 825 m2) of reef. Method 1 calculated the proportion of total catch represented by shells found with soft tissue immediately after fishing. It assumed exact catch was known from each area. Method 2 used an estimate of dead shells after each day of fishing (n=4) and an estimate of dead shells found after four days of non-fishing in order to estimate the incidental fishing mortality. Method 1 estimates were 7%, 20% and 21% of the recreational catch from the same reef area, and Method 2 estimates were 4%, 40% and 52%. Based on the known catch and area from one site (Beaumaris: 3,535 abalone from 825 m2), and an estimated legal-sized density (40 animals per m2) from field surveys, these mortality estimates suggest an incidental fishing mortality in the range of 0.4% to 5.6% of total legal sized stock, suggesting only a minimal impact on stock sustainability but still an unnecessary mortality that should be addressed through an education program. Further trials are required to assess the assumptions of the methodology so they can be scaled to assess incidental mortality over the whole fishery.
The Roe’s abalone fishery near the Perth metropolitan area, Western Australia Hancock, B.T.1,2 & Caputi, N.1* 1. Western Australian Marine Research Laboratories, PO Box 20 North Beach, WA 6920, Australia. Email: bozehanc@cox.net 2. School of Animal Biology, University of Western Australia, 35 Stirling Hwy, Crawley, WA 6009, Australia The recreational Roe’s abalone fishery is concentrated on easily accessible reefs that adjoin metropolitan Perth. There is a restricted recreational fishing season of 1.5 hours a morning, for six consecutive Sundays in November and December each year. The reefs near Perth are also the focus of the commercial Roe’s abalone fishery in Western Australia. The recreational catch and effort for each 10 nautical mile section of the Perth fishery are estimated from creel surveys with instantaneous counts and interviews with fishers, aerial surveys, and mean weight measures, from 1997 to 2000. The majority of the recreational and commercial catches were taken from small areas of the fishery, with approximately 88% of the recreational catch coming from two 10 nm sections, and 98% of the commercial catch coming from these two and one additional 10 nm section. The total catch of between 66 and 81 tonnes for the four years is approximately evenly divided between the recreational and commercial sectors with notable variation in the spatial distribution of the catch between sectors. The recreational catch and effort estimates for 1999 and 2000 were corroborated by an independent telephone survey.
Reconstructing the Anomalodesmata: molecules, morphology and fossils Harper, Elizabeth M1, Dreyer, H.2 & Steiner, G.2 1. Department of Earth Sciences, Downing Street, Cambridge. UK. Email: emh21@cam.ac.uk 2. Institute of Zoology, University of Vienna, Althanstr. 14, A-1090, Vienna, Austria The anomalodesmatan bivalves have always proved rather enigmatic and there have been numerous hypotheses to explain both their relationships to other higher bivalve taxa and also those between the constituent taxa. Widely accepted as an independent evolutionary lineage of Ordovician origin, the Anomalodesmata underwent marked changes in their ecology and abundance over the last 500 million years. During the Palaeozoic and Mesozoic they were common elements of soft sediment faunas but during the Cenozoic, they radiated into often specialised ecological niches (cementers, tube dwellers and carnivores) with a resulting increase in morphological diversity, but they also apparently became much rarer. The resulting divergent morphologies and their general lack of accessibility have conspired to make the phylogenetic analysis of Recent anomalodesmatans challenging. There are no characters exclusive to the Anomalodesmata, and it is apparent that similarities between the constituent lower taxa arose through convergent and parallel evolution. We attempted to integrate morphological and molecular surveys of 34 anomalodesmatan taxa, relating to 12 of the 15 recognised families. Our morphological survey includes 87 conchological and anatomical characters; molecular data come from 18S, 28S and 16S rRNA genes. Maximum parsimony and Bayesian trees support the following key conclusions: (i) the robust monophyly of the anomalodesmatans; (ii) their nesting among the basal heteronconch lineages, unrelated to myoids, (iii) the monophyly of carnivorous taxa studied, and, perhaps most puzzling of all, (iv) the dismantlement of the apparently robust Pandoroidea and Thracioidea as defined on morphological characters. Characters such as secondary hinge teeth, the fourth pallial aperture and chondrophores are shown to be convergently acquired, whilst others such as the prismato-nacreous shell structure, shell spicules and valve equality have been lost several times. Comparison of these new trees with data on the first appearance in the fossil record shows that they are not incongruent.
Growth, mortality, and recruitment in wild stocks of the silver-lipped pearl oyster Pinctada maxima, in Western Australia. Hart, Anthony M. & Joll, Lindsay M. Department of Fisheries Western Australia, Western Australian Marine Research Laboratories, PO Box 20, North Beach, WA 6020 Australia. Email: ahart@fish.wa.gov.au; ljoll@fish.wa.gov.au Growth, mortality and recruitment experiments were undertaken on wild stocks of the silver-lipped pearl oyster Pinctada maxima at sites spanning the geographic range of the commercial fishery. Three mark-recapture studies yielded 2717 individual growth increments (initial size: 10 – 217 mm DVM; time at liberty: 346-745 days), which were combined with data from cohort analysis of younger age classes, and growth estimated using maximum likelihood methods. Natural mortality was determined from tag and recapture studies at fixed sites, and by measuring in situ length-frequency structure of stocks and applying length converted catch-curve analysis. Settled P. maxima spat on adult shell were quantified (119 000 shell produced 1317 spat in 2003) to obtain an annual recruitment index. Growth parameters (L¥ , K) from the von Bertalanffy growth equation were estimated to be 210 mm DVM (± 16 mm SD) and 0.74 at the Lacepede Islands, 199 mm DVM (± 6 mm SD) and 0.79 on 80 Mile Beach, and 194 mm (± 1 mm SD), 0.72 in Exmouth Gulf. Estimates of natural mortality (M) by tagging were very low (0.02-0.03), but catch-curve analyses yielded M estimates from 0.10 in deeper (30-34m) populations, to 0.18 in shallow (9-12m) populations. Pinctada maxima spat were easily separated into 0+ and 1+ age classes, and showed clear temporal trends in abundance. The annual recruitment index over 7 years (1992-1995; 2001-2003) varied from 5.1 to 8 spat per 1000 shell for the 0+ age class, and 3.5 to 6.2 spat per 1000 shell for the 1+ age class. More work is required on spatial and habitat effects on spat settlement before the potential of the 0+ and 1+ recruitment indices as predictors of future stock abundances can be fully explored.
Interpreting the significance of the uppermost Cretaceous nonmarine mollusks of the Deccan Plateau of India Hartman, Joseph H. Department of Geology and Geological Engineering, University of North Dakota, PO Box 8358, Grand Forks, ND 58202 USA. Email: joseph_hartman@und.nodak.edu The origin of the diverse assemblage of uppermost Cretaceous intertrappean nonmarine gastropods and mussels begs for an explanation. Although a substantial number of the known taxa of peninsular India were described, however briefly, by James Sowerby and Stephen Hislop in the mid-1800s, their rapid evolution and diversification, while India was apparently sequestered from possible biogeographic contact, has received virtually no attention. Recent studies in Madagascar have shown that the dinosaurs and mammals of the Indian and Malagasy vertebrate fauna are nearly identical indicating Gondwanan affinities. Also, now, a Maastrichtian age is interpreted for the latter. The Indian freshwater molluscan fauna consists mostly of caenogastropods, pulmonates, and unionoids. The evolutionary lineages represented by this fauna do not appear to be represented in the earlier Mesozoic record of India prior to or including the Lameta Formation (infratrappean Maastrichtian) and Deccan volcanism. Preliminary studies have documented at least 68 nonmarine molluscan localities from strata of the Deccan Plateau and adjacent areas. About 9% of these localities are infratrappean and of very-low-diversity unionoid faunules. The remaining are intertrappean faunules comprising a species-rich fauna of at least 36 taxa. The potential significance of the molluscan fauna is in its implications in supporting or interpreting 1) a possible rapid in situ evolution of a diverse molluscan fauna (<1 Ma from origination to partial[?] demise) from a heretofore unknown austral stock; 2) an early Indian–Eurasian plate interaction (collision) providing new drainage patterns and thus dispersal routes for molluscan colonization; and 3) the influence of Deccan volcanism on habitat stability, climate change, and species extinctions in that freshwater mollusks occupy intertrappean sediments through a number of basalt flow events.
Extinction dynamics near the K/T boundary: Evidence from the nonmarine molluscan record of the Western Interior of North America Hartman, Joseph H.1* & Scholz, H.2 1. Department of Geology and Geological Engineering and Energy & Environmental Research Center University of North Dakota, Box 8358, Grand Forks, ND 58202 USA. Email: joseph_hartman@und.nodak.edu 2. Museum für Naturkunde, Humboldt University, Institute for Paleontology, Invalidenstrasse 43, 10115 Berlin, Germany The North American Cretaceous–Tertiary (K/T) record is particularly well-documented with well-preserved freshwater mollusks in the northern Great Plains. The pattern of nonmarine molluscan extinction about the K/T boundary, where it can be well-defined and/or carried by proxy data, suggests that a bolide impact did not initiate the demise of the fauna. A significant percentage of unionoid bivalve taxa including the sculptured unionoids and a sculptured gastropod appear to have become extinct just before, not at, the K/T boundary. Recent studies have shown that an advance of the Cannonball Sea near the very end of the Cretaceous in the Western Interior was most likely responsible for the destabilization of freshwater molluscan habitats by changing base level. Such transgressive events are well known earlier in the Cretaceous and produced major molluscan faunal crises, but with less dramatic long-term consequences. The presence of a fluctuating Cannonball Sea during the first 5 Ma years of the Paleocene has led to unstable environmental conditions reducing the survival chances and recovery possibilities of unionoid species harbored in refugia thought to have persisted after the impact event. A base level change would have also resulted in a new depositional (and thus preservational) regime near the end of the Cretaceous. The common large fluvial channels and numerous crevasse splays rich with freshwater mollusks of the Hell Creek changed to broad alluvial plains with slack water settings, ultimately leading to coal-forming environments very near to or at the K/T boundary. The resulting depositional regime would provide less chance for preserving surviving K/T impact victims. Ultimately, elongate bivalves with unsculptured valves or valves with only low beak or postumbonal sculpture were to be the only extant unionoids in the Western Interior of North America during the Paleogene.
Swimming behavior of scissurellids (Gastropoda: Scissurellidae), and its taxonomical significance Hasegawa, Kazunori Tsukuba Research Center, National Science Museum, 4-1-1 Amakubo, Tsukuba, Ibaraki 305-0005, Japan. Email: hasegawa@kahaku.go.jp
Scissurellidae are a group of small to minute gastropods, inhabiting in intertidal to deep waters throughout the world oceans. Although nearly 150 species have been described in 25 nominal genera, little is known about their biology, mainly because of their small size. During a research cruise of T/V Toyoshio-Maru of Hiroshima University in Okinawas, southern Japan, in 2004, a mass swimming behavior of scissurellids was observed in the field, and reported here with its taxonomical significance. The mass swimming of scissurellids was observed in ports at three islands: Iheya on 22 May, Ie on 23 May, and Okinawa (Naha port) on 25 May. The scissurellids were attracted to an underwater light for luring fish, and collected with a plankton net. They were observed to swim continuously by vigorously shaking their foot, and discharge eggs or sperms in a container. A detailed examination of the collected specimens revealed that they comprise three species: Scissurella staminea (A. Adams, 1862), Scissurella sp. (undescribed) and ‘Sinezona’ plicata (Hedley, 1899). Although the latter species possesses a foramen, not an open slit, and can superficially be assigned to the genus Sinezona, unique head-foot features, such as large eyes, a large operculum situated on the left side of the body, and a large and laterally compressed foot, agree with those of other two species. Furthermore, the basic plan of the protoconch of these three species was revealed to be essentially the same. The characters are also shared by Sukashitrochus species, in which swimming behavior has also been reported. Accordingly, the formation of a foramen has little taxonomical value, and Scissurella (with an open slit), Sukashitrochus (with a foramen) and a part of the species previously assigned to ‘Sinezona’ (with a foramen) are shown to form a natural group.
In search for a sistergroup of Mollusca: the case of Entoprocta (Kamptozoa) Haszprunar, G.1 & Wanninger, A.2 1. Zoologische Staatssammlung and University of Munich (LMU), Muenchhausenstr. 21, D-81247 Munich, Germany. Email: haszi@zsm.mwn.de 2. Zoological Institute, University of Copenhagen, Universitetsparken 15, DK-2100 Copenhagen, Denmark. Email: awanninger@zi.ku.dk During the last decade molecules and morphology have established the systematic position of the Mollusca among the Lophotrochozoa, where they form a clade Trochozoa together with Entoprocta (= Kamptozoa), Sipuncula, Myzostomida, and Annelida. However, the question of the direct sistergroup of Mollusca is still unresolved. To establish the morphologically based hypothesis of a sister-group relationship to the Entoprocta, we have investigated (late) creeping larvae of the entoproct Loxosomella murmanica (Nilus, 1909) by means of ultrastructure (SEM and TEM), fluorescence-coupled phalloidin (muscle-labelling) and immunocytochemical methods for neural characters combined with confocal laser scanning microscopy (CLSM). Unique characteristics of the entoproct larva include the paired ciliated pits in front of the apical organ, the so-called "frontal organ", which lacks eye spots in L. murmanica, and epidermal, myoepithelial cells with obliquely striated muscle fibres. The larva of L. murmanica is not able to feed, since the gut does not show a lumen throughout its length. Electron microscopy and anti-serotonin immunoreactivity identified a pair of ventrally situated nerve cords and a prototroch ring, which is connected with the cerebral commissur via another pair of serotonergic nerves. At present direct homologies with the molluscan tetraneural nervous system could not be unequivocally established. The larva of Loxosomella shows a creeping sole with several characters shared by primitive molluscs, particularly Solenogastres, the latter are considered to represent the earliest offshoot of Mollusca: (1) The anterior end is equipped with compound cilia (cirri); (2) large, subepithelial mucous glands, which extend into the head region, open nearby; (3) The dorsoventral muscle fibres are smooth and their inner parts intercross immediately above the foot sole - a character so far unique in molluscs; (4) The anal opening opens dorsally of the creeping sole. All these data strongly suggest direct homology between the larval entoproct and the original molluscan creeping sole. Both, entoproct larva and certain (?) small Solenogastres, also show paired, specific mucous cells with several vacuoles in the dorsal hyposphere. Entoprocta and (aculiferan) Mollusca further share a chitineous cuticle (contrary to collageneous cuticles in Sipuncula, Myzostomida, and Annelida) and (except Stylommatophora and Cephalopoda) a sinusial circulatory system. According to the given data, we confirm the proposed direct sistergroup relationship of Mollusca and Entoprocta and await further supporting evidence from molecular studies. Acceptance of this hypothesis has also implications for the early phylogeny of Mollusca itself, since it provides direct outgroup comparison and establishes the basal position of the Solenogastres.
Latitudinal and altitudinal diversity patterns and Rapoport effects in north-west European land snails Hausdorf, B. Zoologisches Museum der Universität Hamburg, Martin-Luther-King-Platz 3, 20146 Hamburg, Germany. Email: hausdorf@zoologie.uni-hamburg.de There are Rapoport effects in the latitudinal and altitudinal range size patterns of the north-west European land snail fauna. These effects are not caused by northern respectively high altitude species with wider latitudinal/altitudinal ranges and southern/low altitude species with narrower latitudinal/altitudinal ranges as predicted by the climatic variability hypothesis, but mainly by different northern/upper borders of species occurring in the south of the study area or at low and intermediate altitudes, respectively. This pattern indicates that the observed Rapoport effect is mainly due to differential northward/upward expansion of species which were restricted to southern/low or intermediate altitude refuges during the glacials. Although all species occurring in a refuge experienced the same climatic conditions, there is stochastic variation in their climatic tolerances. Species with broader climatic tolerances were able to expand farer northwards/upwards in the postglacial. The altitudinal distribution of species richness in the analysed alpine faunas cannot be explained by the Rapoport-rescue hypothesis, because species richness peaks at intermediate altitudes and because there is no negative correlation between the number of range borders and altitude. The Rapoport-rescue hypothesis alone is probably also insufficient to explain the decrease of species richness with increasing latitude, because the correlation between the number of latitudinal range borders and latitude is weak.
Phylogeography and evolution of the Florida crown conch (Melongena corona) Hayes, Kenneth A. University of South Florida, Department of Biology, 4202 East Fowler Ave, Tampa, FL 33620 USA. Email: khayes@hawaii.edu Snails of the Melongena corona species group are predatory marine gastropods that inhabit sheltered, typically estuarine, embayments from Little Lagoon Alabama in the west to Matanzas Inlet on the east coast of Florida. Current taxonomic designations for the group are based predominantly on shell shape, color, spination, and geographic distribution. Shell morphology in gastropods may be phenotypically plastic and readily affected by changes in environmental conditions (e.g. temperature, salinity, wave action, predation, diet, etc.). Extraordinary phenotypic plasticity within this group makes it difficult to clarify the relationships within and among populations of Melongena using only shell morphology. Additionally, Melongena is a case where populations of a highly philopatric species live in discrete habitats separated by uninhabitable areas. Under this scenario, it is possible for large numbers of genetically distinct but ecologically similar populations to develop, and conceivably become reproductively isolated over time. To better evaluate the phylogenetic relationships within this group, fragments of the 16S and COI mtDNA genes were sequenced and compared from all putative species within the genus. Furthermore, individuals from 19 populations have been genotyped at eight microsatellite loci. Phylogenetic analyses completed with these data provide no support for the putative species designations within this group and suggest that the corona complex is composed of a single polymorphic species. Furthermore, microsatellite data reveal population structure consistent with restricted gene flow between extant populations and phylogeography heavily influenced by historical sea-level fluctuations during the Late Pleistocene.
Systematics, phylogeography and evolution of apple snails (Pomacea spp.) Hayes, Kenneth A. University of Hawaii-Manoa, Department of Zoology, 2538 McCarthy Mall, Edmondson 152. Honolulu, HI 96822 USA. Email: khayes@hawaii.edu The freshwater apple snail genus Pomacea (Ampullariidae) has a native range covering most of South and Central America and the southeastern U.S. Species of Pomacea have been introduced widely in southern and eastern Asia, Hawaii and other Pacific islands, and in the mainland U.S. In their introduced ranges they have become major pests of wetland crops, notably rice and to a lesser extent taro. The taxonomy of Pomacea, including the identity and precise geographic origins of the pest species, is poorly understood. This lack of understanding has implications for research on many aspects of ampullariid biology, including development of effective pest management programs. Ampullariids are a major component of freshwater diversity throughout the tropics and subtropics. Pomacea, with 117 recognized species, is the largest genus. Pomacea spp. are therefore important from various perspectives, including ecosystem and human health (as vectors of human parasites). They also offer a valuable model for investigating Neotropical biogeography. As part of a systematic revision of the genus Pomacea, DNA sequence data are being used to develop a phylogenetic basis for hypotheses of the evolution of Neotropical freshwater biodiversity. So far, 56 individuals encompassing 7 putative Pomacea species have been analyzed. Snails from Hawaii, numerous south-east Asian locations, and Argentina cluster together and are probably Pomacea canaliculata. Snails from introduced populations in Sri Lanka and from pet stores in Australia are Pomacea bridgesii. Snails intercepted by quarantine officials in Hawaii cluster with specimens from Venezuela and Thailand and are probably Pomacea lineata, native to northern South America. Among the putative species average pairwise distances calculated under a general time reversible substitution model from the cytochrome c oxidase subunit I sequences range from 9.9 % between P. canaliculata and P. lineata to 22.0 % between P. glauca and P. bridgesii.
Populations of freshwater Neritidae and Thiaridae in an open concrete drain in Fiji Haynes, A. Institute of Applied Sciences, University of the South Pacific, P.O.Box 1168, Suva, Fiji. Email: alisonh@connect.com.fj From 1994 – 1998 ten species of Neritidae and five of Thiaridae lived in an open concrete drain in Fiji. The density, size structure and movement of the populations of the two families were estimated and compared by taking samples at eight sites 600 – 640 m upstream from the sea. The neritid population reached a density of 800 individuals m-2 600 m from the sea, while the thiarid population had a peak of 855 individuals 20 m further upstream. In March the size of the most abundant neritids was between 0 –6 mm, suggesting that a cohort had recently settled. The abundance of sizes between 6 - 21 mm was evenly spread. The thiarids size structure varied little between 0 – 21 mm high, indicating that the population had been continuously reproducing. In a series of experiments, marked specimens of Neritidae and Thiaridae over 10 mm , were placed at the eight sites in the drain, recaptured after 7 days and the distance each moved was measured. There was no significant difference between the numbers moving upstream and downstream. The furthest movement of any individual upstream in 7 days was 35 m. It was found that the neritid species present at each site was different each day. Clithon pritchardi was the most abundant species. The Neritidae species present were C. pritchardi, Clithon diadema, Clithon corona, Clithon olivaceus, Neritina variegata, Neritina turrita, Neritina turtoni, Neritina canalis, Neritina pulligera and Septaria suffreni and the Thiaridae species were Melanoides aspirans, Melanoides plicaria, Melanoides arthurii, Thiara scabra and Thiara amarula. Fifteen species were able to coexist because predators were absent and periphyton was abundant. Each species population was mainly limited by density independent factors such as heavy rain and varying salinity, temperature and shade.
In pursuit of cost-effective enhancement of mollusc fisheries, using blacklip abalone Haliotis rubra as a case study Heasman, Michael P. Port Stephens Fisheries Centre, Private Bag 1, Nelson Bay, NSW 2315 Australia. Email: michael.heasman@fisheries.nsw.gov.au The components of responsible marine stock enhancement are briefly reviewed. The basis of economic success of fisheries enhancement boils down to answering two interrelated questions. The first question is, "what is the margin by which revenue per unit of additional sustainable production is likely to exceed that of the cost?" Such costs include those of producing and deploying the seed plus harvesting and post-harvesting costs through to the point of sale. The second question is, "what probable scale of additional production is needed to make the whole exercise worth pursuing in the first place?" While the questions themselves are straight forward, providing answers, particularly determining the most cost-effective size and age of seed and how best to produce and deploy them, is likely to be time-consuming, complex and expensive, requiring both innovative biotechnology and a comprehensive knowledge of the natural biology of the species. Elements of biology that must be considered include age and size specific growth and mortality rates of wild stocks from settlement to market size and factors that control them and the production capacity of particular areas and sub-populations. For reef species such as abalone, this also entails an understanding of key inter-relationships with other community species especially those that compete directly with them for space, shelter and food. Urchins are primary competitors of abalone but other surface grazing and seaweed-eating molluscs may also be important. Continuing endeavours to develop cost-effective enhancement of the NSW blacklip abalone fishery, are used as a case study.
Public education to promote America's threatened mollusks Helfrich, L.A.* & Neves, R.J Department of Fisheries and Wildlife Sciences, Virginia Tech, 152 Cheatham Hall, Blacksburg, VA 24061-0321 USA. Email: lhelfric@vt.edu Declining biodiversity worldwide is a major environmental catastrophe. Aquatic fauna in the U.S. are in fact disappearing at a faster rate than that elsewhere on the planet. At issue are the nearly 300 species of mussels, 800 species of fishes, 300 species of crayfishes, and 500 species of snails that inhabit freshwater lakes and streams in the United States. These and other aquatic organisms serve as important indicators of water quality and ecosystem health. At present, nearly 20% of our fishes, 45% of our mussels, 48% of our crayfish, and 20% or our aquatic snails are imperiled. Public education is one of the keys to aquatic biodiversity conservation. For public school teachers who lack of resources, time, funding, and access to current, relevant information is critical to incorporating biodiversity topics into there already overloaded curriculums. We have developed multimedia aquatic education programs and products designed to enhance public awareness and facilitate aquatic biodiversity education in the classroom. The educational materials are intended to establish the framework for promoting aquatic biodiversity in public schools nationally. They depict the richness and unique ecological values of aquatic animals, especially freshwater mollusks. These award-winning video-poster-publication educational packages have been widely featured on Public Television and in the classroom. Production of these highly effective educational products and programs will be reviewed and the conservation implications of this program will be discussed.
Hybridization: Lofty theories, mollusk reality Heller, J. Department of Evolution, Systematics and Ecology, The Hebrew University of Jerusalem, Jerusalem 91904, Israel. Email: heller@vms.huji.ac.il Evolutionary theory suggests that hybrids are less fit than their parental species and hence that hybrid populations are ephemeral, on a geological timescale. It is further commonly suggested that most Recent hybrid zones became established merely fifteen thousand years ago, after retreat of the glaciers. Mollusks form an exceptionally precise tool for investigating hybridization through time, since the shell, which may be preserved as a fossil, is also the feature upon which Recent inter- and intra-species level taxonomy is frequently based. I exploit this combination of facts to investigate the taxonomy of Recent Melanopsis of the Jordan Valley; and to explore how long ago could hybrids be traced, in the fossil record of the Jordan Valley. Shell morphology (supported by analysis of radula, sperm and isozymes) establishes that Recent Melanopsis include buccinoidea, costata and buccinoidea / costata hybrids. Also at a 1.4 Myr old site in the Jordan Valley buccinoidea and costata were found; and with them buccinoidea/costata intermediates. Their low frequency and chrono-distribution suggest they are hybrids, rather than evolutionary transitions between species. These 1.4 Myr old fossils may be the earliest direct evidence of hybridization among mollusks in nature, that is still going on today in the same region and aquatic system, among the same species. This scenario is not in agreement with evolutionary theory.
Phylogenetic relationships of the enigmatic genus Prestonella – the missing African element in the Gondwanan family Bulimulidae (Pulmonata). Herbert, D.G.*1 & Mitchell, A.2 1 Natal Museum, P. Bag 9070, Pietermaritzburg 3200, South Africa, and School of Botany & Zoology, University of KwaZulu-Natal, P. Bag X01, Scottsville, Pietermaritzburg, 3209, South Africa. Email: dherbert@nmsa.org.za2 School of Molecular and Cellular Biosciences, University of KwaZulu-Natal, P. Bag X01, Scottsville, Pietermaritzburg, 3209, South Africa. Email: mitchella@ukzn.ac.zaThe endemic genus Prestonella Connolly, 1929, has long been an enigma within the southern African terrestrial malacofauna. In the absence of anatomical data, assessments of its relationships were based solely on the rather characterless shell. As a result, it has been referred to a number of different families, but never with any firm evidence. In this paper we present new morphological and molecular data from recently collected specimens, which conclusively demonstrate that Prestonella is referable to the family Bulimulidae. This family, which has long been considered part of the Gondwana fauna, is widely distributed in South and Central America, and parts of Australasia, but the majority of recent authors have considered it to absent from Africa. Now we are able to demonstrate a classic tri-continental distribution for the family. Sequence data from part of the rRNA gene cluster were compared with homologous sequences for 120 pulmonate taxa used in a recent phylogenetic analysis of the Stylommatophora. All methods of analyses performed placed the two available Prestonella species as sister taxa (99-100% bootstrap support), and placed Prestonella as the sister group of Placostylus (98-100% BP), in the family Bulimulidae. This result is strongly supported by anatomical evidence (from several unrelated suites of characters) which reveals considerable morphological similarity between Prestonella and members of the Bulimulidae. The relationships of Prestonella within the Bulimulidae remain to be established, but in any event, it is clear that the African bulimulid stock must have been isolated on this continent for a minimum of ca 110 million years. Evidently it is now represented solely by the genus Prestonella (3 described species) and is restricted to island-like, probably relictual, habitats along the southern edge of the Great Escarpment in South Africa and Lesotho.
Long-term population dynamics of unionoid mussels in the St. Croix River, Minnesota and Wisconsin, USA Hornbach, D.J.* & Hove, M.C. Department of Biology, Macalester College, St. Paul, MN 55105 USA. Email: hornbach@macalester.edu The diverse mussel community in the St. Croix River (an upstream tributary of the Mississippi River) is a nationally recognized resource. We quantitatively assessed mussel communities and habitat from 1991-2003 at 8 locations. Each location was sampled a minimum of 3 times during this period, with three locations being sampled 5 times. Thirty-five species of mussels were collected in quantitative samples, although the river contains >40 species of unionoids including two federally endangered species. Mussel density varied from 2.5 to 38.5 mussels/m2, depending on year and location. Large mussel density (> 30 mm shell length) declined over the period at most sites, with an average decline of 57%. The decline was not statistically significant due to the large within-site variability in density. Likewise there was a decline in small mussel density (<30 mm shell length), averaging 69%. These declines were statistically significant, especially at sites located downstream of a hydroelectric dam on the river. Shell-length frequency diagrams suggest there has been little recruitment or there is low juvenile survival among many dominant species at many sites. At some sites there has been an increase in fine sediments, although this is variable among sites. The site with the greatest decline in small mussel density has had the largest increase in fine sediments and is located just downstream of the hydroelectric dam. This site houses the largest known population of the endangered winged mapleleaf mussel and one of the few populations of endangered Higgins eye mussel not threatened by the invasive zebra mussel, Dreissena polymorpha. The causes for the overall decline in the health of the mussel communities are unknown but could include an increased human population in the watershed, the invasion of zebra mussels in lower reaches of the river, and increased recreational use of the river.
Embryonic and larval development of the tropical black-lip rock oyster Saccostrea echinata Horpet, Phusit* & Southgate, Paul School of Marine Biology and Aquaculture, James Cook University, Queensland 4811, Australia. Email: Phusit.Horpet@jcu.edu.au The tropical black-lip rock oyster Saccostrea echinata has high potential for aquaculture in tropical Australia and the Indo-West Pacific region. Despite several studies conducted with this species, it has not received the same level of research interest regarding its mariculture potential as temperate rock oysters. There is a paucity of information on the basic biology of S. echinata, and little is known of embryonic and larval development in this species. This paper presents a description of embryonic and larval development of S. echinata, using digital photomicroscopy and video clip images. Growth rates of larvae under hatchery conditions, and morphology of the larval shell (size, prodissoconch development), are described. The development of embryos and larvae is compared to those of other oyster species. S. echinata has the fastest development to the trochophore and veliger stages so far recorded for Ostreid larvae. Trochophore larvae develop 5.5 hours after fertilisation while D-stage veligers first appear 12.5 hours after fertilisation. This study is part of my PhD thesis on the topic "Aquaculture potential of the tropical black-lip oyster S. echinata".
Ovary cell differentiation and morphology of mature ovocyte in Fisurella crassa Lamarck, 1822 (Mollusca: Archaeogastropoda) Huaquín, Laura G., Guerra, Rosa* & del Campo, Angelica T. Facultad de Ciencias Veterinarias y Pecuarias, Universidad de Chile and Instituto de Biología Universidad de Valparaíso. Email: lhuaquin@uchile.cl Fissurella crassa is an archaeograstropoda of the intertidal Chilean coast of South America. It is an important natural resource and a potential species for culture or biotecnologic asssays. Therefore, microscopical studies for the characterization and descripción of germ cell maturation are necessary to know the cycles of its fertilization periods. Living specimens of minimun 45 mm long. were colected in Caleta Montemar (V Region of Chile) in august, october and december of 1997 and febrary, april of 1998 (n=60). The histologic analysis used 5 µm sections stained with eosin-hematoxilin, van Gieson and PAS (Peryodic-Acid Schiff). Transmission electron microscopy (TEM) techniques were also used. Four classes of ovary madurity stages are described: stage 1, early; stage 2, avanced; stage 3, mature and stage, ovulation. An early and an advanced germinal line were determined within the ovary's structural characteristics. Samples of all the cell stages of the germinal line were obtained each month, with one cell stage predominaring, according to the annual ovary maturity period. Mature ovocytes obtained from five females measured 317,04± 31,36 µm in total diameter (n=150), while bare cells (without jelly layer) measured 228,85± 22,47 µm. The cell covering first show a viteline coat; then it continues with a translucid jelly layer, with a number of structures like pits with a wide and regular spreading; then comes a third peripherical ribbon-like fibrilar material of lightly density; finally there is a very dense laminar coat, known as corion. The presence of a complex and well-defined structure like a pore should be noted. This continues as a canal that perpendicularly crosses all the cell coverings towards and contacting the plasma membrane. This species exhibits a continuous reproductive cycle with partial spawning and with some mature specimens throughout the year. Project DID N-3506 Universidad de Chile and DIPUV 32/2003
Morphological changes in the reproductive system of females affected with imposex in populations of Acanthina monodon (Pallas, 1774) (Gastropoda: Muricidae) in Chilean coasts Huaquín, L.G.1*, Osorio, C.2 & Collado, G.2 1. Facultad de Ciencias Veterinarias y Pecuarias and 2. Facultad de Ciencias, Universidad de Chile. Email: lhuaquin@uchile.cl Imposex or imposed sex, a symptom detected over 30 years ago in the Northern Hemisphere in populations of several marine gastropods species consisting of penis growrh in females, is induced by organotin compounds like tributyltin, trifenyltin, difenyltin, leach into the environment from antiincrustation paints applied to wharves and boats. In Chile it has been recognized since 1998 in neogastropods. The study made in A. monodon populations led us to determine that the populations of this species present imposex in a high percentage. In samples from the intertidal zone in localities between 32ŗ55´S/71ŗ38W and 33ŗ57S/71ŗ52W (Playa Amarilla, Las Salinas, El Tabo, Las Cruces y and Matanzas), gastropod sex was anatomically determined by the presence or absence of penis and the presence of the capsule gland in females. The histological study of the reproductive system carried out with longitudinal and cross-sectional of complete animal. Out of the 319 analyzed individuals, 62.8% were male and 35.3 % females. Sevety-seven per cent of the females presented imposex, reaching 100% at El Tabo and Las Salinas. In the samples of Matanzas, a smaller mean percentage of imposex was observed. Acanthina females with imposex showed masculinizaction symptoms together with involution of their own organs with possible duct blocking. Acanthina sp females exhibited a shorter penis than males. In severe imposex cases there was an involución of the normal tissue of the capsule gland. This condition might prevent the formation of the material that surrounding the eggs, a phenomenon that would result in sterility. It would also be the cause of the decrease of female individuals within the populations and consequently of the decreased populations near the polluted areas. Project DID CSMAR 02/3-2, Universidad de Chile.
A phylogeny of basal gastropods based on five molecular loci Huff, Stephanie W. * & Giribet, Gonzalo Department of Organismic and Evolutionary Biology and Museum of Comparative Zoology, Harvard University, Biolabs Rm 1119, Cambridge, MA, 02138, USA. Email: shuff@oeb.harvard.edu Relationships among gastropod clades such as the Vetigastropoda, Patellogastropoda, Neritopsina, Cocculiniformia, and the hot-vent taxa vary significantly between analyses based on morphological and molecular data sets. These relationships are tested in a preliminary analysis using evidence from nuclear ribosomal (18S rRNA and partial 28S rRNA), mitochondrial ribosomal (16S rRNA), nuclear protein coding (histone H3) and mitochondrial protein coding (cytochrome c oxidase subunit I) genes. Data were obtained from 31 gastropod specimens representing 26 different families. Phylogenetic analysis via direct optimization of DNA sequence data using parsimony as optimality criterion is executed for different combinations of parameter sets accounting for different indel costs and transversion/transition ratios in a sensitivity analysis framework. The stability and support of the recovered clades is explored and the results of this analysis are compared to those from other molecular and morphological data sets.
Helicarionidae (Pulmonata, Stylommatophora) in Australia: taxonomy, systematics, and the evolution of shell reduction Hyman, Isabel T. School of Biological Sciences (A08), University of Sydney, Sydney, NSW 2006, Australia and Australian Museum, 6 College St, Sydney NSW 2010, Australia. Email: ihyman@bio.usyd.edu.au Helicarionidae sensu lato is a group of snails and semislugs distributed mainly in Australia, the Pacific Islands and southeast Asia. The delineation and relationships of this group are poorly understood. In the current study, approximately 60 taxa from around Australia (including Lord Howe Island and Norfolk Island) are included in a phylogenetic analysis, using both morphological and molecular data. These data include characters from the digestive, reproductive, excretory and nervous systems, and also three mitochondrial genes: cytochrome c oxidase subunit I (COI), the transfer RNA coding for valine (tRNA-Val), and the ribosomal large subunit gene 16S. Gene sequences have not previously been used in studies of Helicarionidae, but are particularly relevant since many aspects of the morphology may be convergent. Based on these data, Helicarionidae is redefined, as are the subfamilies Helicarioninae, Sesarinae and Microcystinae. A new synapomorphy noted for Microcystinae is the absence of tRNA-Val from its expected position, probably due to a change in gene order. The relationships among the Australian taxa are also revised. In addition, the relationships of Australian Helicarioninae and Microcystinae to other groups (Euconulinae, Ereptinae, Trochomorphidae, Urocyclidae, Ariophantidae, Cystopeltidae) are discussed. There are extensive radiations of Helicarionidae on Lord Howe Island and Norfolk Island. Only the group Microcystinae occurs on Norfolk Island, and the taxa appear to have evolved from a single introduction. On Lord Howe Island Helicarioninae and Microcystinae are both present. The Helicarioninae appear to be a monophyletic group originating from the east coast of Australia, and the Microcystinae may have originated from Norfolk Island. The evolution of shell reduction in Helicarionidae is also discussed. It appears that shell reduction has evolved many times in this group, but never to the extent of total shell loss. Shell reduction also occurs in Microcystinae, but much less frequently.
Spermatozoan morphology of Brachidontes darwinianus and B. solisianus (Bivalvia, Mytilidae) from the southern Brazilian coast Introíni*, Gisele Orlandi, Aguiar, Jr., Odair, Quaresma, Alexandre José Christino, Neto, José Lino, de Magalhães, Cláudia Alves, Recco-Pimentel, Shirlei Maria Universidade Estadual de Campinas, Instituto de Biologia, Departamento de Biologia Celular, Campinas 6109, Brazil. Email: g021587@dac.unicamp.br Numerous investigations have demonstrated the usefulness of sperm morphology in evaluating molluscan phylogeny. In this work, we used transmission and scanning electron microscopy to study the structure of mature spermatozoa from two bivalves, Brachidontes darwinianus and B. solisianus, and compared them with those of other bivalves, particularly other mytilids. These two species have a wide geographic distribution and are particularly abundant in the intertidal zone of many rocky shores along the Brazilian coast, often in areas with strong water currents. Brachidontes darwinianus occurs from the state of Rio de Janeiro, Brazil, to Patagônia, in Argentina, whereas B. solisianus is distributed from Mexico to Uruguay. The spermatozoa of both species were of the primitive type or ect-aquasperm form. In both species, the spermatozoan head contained a spheroidal nucleus capped by a conical acrosome with an anterior extension. The chromatin was strongly electron-dense, homogenous and compact in texture. The nuclei contained randomly distributed, electron-lucent regions formed by invaginations of the nuclear envelope. These invaginations were detected by E-PTA staining for glycoproteins at low pH. The mid-piece region consisted of five spherical mitochondria grouped in a ring around a pair of short cylindrical centrioles. The flagellum exhibited the typical 9+2 microtubule structure (9 double outer tubules + 2 single central tubules). These findings, together with conchological characteristics, can be used to distinguish between B. darwinianus and B. solisianus. The only difference in the morphology of spermatozoa from these two species was the longer anterior extension of the acrosomal vesicle in B. solisianus. This elongated acrosome may facilitate penetration of the jelly coat and cytoplasm of large oocytes and could increase the efficiency of fertilization. The resulting enhanced reproductive success could account for the wider geographic distribution of B. solisianus.
Occurrence of giant octopus, Haliphron atlanticus Steenstrup, 1861, in Skagerrack and further north in the Northeast Atlantic Jensen, Kathe R. Zoological Museum, Universitetsparken 15, DK-2100 Copenhagen Ø, Denmark. Email: krjensen@zmuc.ku.dk Seven specimens of the large octopod species Haliphron atlanticus Steenstrup, 1861 have been recorded from Danish and Swedish waters between August and December 2003. Six of these were caught in shrimp trawls in Skagerrack (about 58°N and 10°E) and one was found dead and washed up on the beach in southern Kattegat (about 56°N and 12°E). An additional specimen was caught just south of Bergen, Norway in November 2003. Prior to 1983 H. atlanticus had not been recorded north of 42°N or east of 12°W in the Atlantic Ocean except for beaks found in the stomach of a sperm whale caught off Iceland (65°N; 29°E). Between 1983 and 1999 single specimens were recorded from Norway (3), the Shetland Islands (2) and Skagerrack (2). Most of these specimens have been caught at depths of 170-250 m. All specimens for which sex has been determined, have been females. Sizes have ranged from 2-3 kg to about 40 kg. The animals appear to have been caught in the warm North Atlantic Current (the Gulf Stream) and transported north through the Faroe-Shetland Channel and then either east into the Skagerrack or north along the coast of Norway. The most recent captures are 5 specimens caught between 29 February and 26 March 2004 by the fisheries research vessel of the Faroe Islands. Two were caught east of the Faroe Islands at 186 and 225 m depth; three were caught west of the Faroe Bank at depths between 620 and 740 m.
Abundance and diversity of molluscs from soft-shallow bottoms of Cariaco Golf, Sucre State, Venezuela Jiménez, Mayre, Galindo, Lee*, Allen, Thays & Marín, Baumar Instituto Oceanográfico de Venezuela, Departamento de Biología Marina, Universidad de Oriente, Apdo. 245. Cumaná, Edo. Sucre, Venezuela. Email: mjimenez@sucre.udo.edu.ve, mairej@hotmail.com Cariaco Golf, represent a natural hatching area of shores in Sucre State-Venezuela, so there, molluscs is a frequent and abundant group of marine benthos. A soft-shallow bottom molluscs list was done. Abundance, Diversity, Evenness and Specific Richness was estimated based on data obtained from twelve stations in south Cariaco Golf from July’96 to May’97. Samples were taken using a Birg Ekman drag between 0 to 2 m of depth and preserved in 6% formalin. A total of 261 individuals were collected (34 species). Only gastropods and bivalves were captured. Gastropods presented 118 organisms, corresponding to 19 species from 13 families, while there were 143 bivalve especims (15 species of 11 families). The most abundant taxa were: Hetorodonax bimaculatus (28), Chione cancellata (27) and Anadarra notabilis (17). Both, C. cancellata and A. notabilis were continually found in all the stations through the study. There were also registered accidental (29) and accessory (2) species and related considerations are dicussed. The general Diversity and Evenness values were 4.61 bits/ind and 1.91, respectivaly. The gastropod Diversity Index was 3.91 bits/ind and eveness was 0.92. The same estimations for bivalves were 3.38 bits/ind and 0.87, respectively. Results could indicate that the molluscan community of soft and shallow bottoms from south Cariaco Golf, is closely related with substrate, which is mainly composed by fine grain materials. Zonation arguments are included.
Evolutionary genetics of island and mainland species of Rhagada (Gastropoda: Pulmonata) in the Pilbara Region, Western Australia Johnson, Michael S.*1, Hamilton, Zoe R.1, Murphy, Colleen E.1, MacLeay, Claire A.1, Roberts, Ben1 & Kendrick, Peter G.2 1. School of Animal Biology, University of Western Australia, Crawley, WA 6009, Australia. Email: msj@cyllene.uwa.edu.au 2. Department of Conservation and Land Management, PO Box 835, Karratha, WA 6707, Australia Mainland species of the camaenid genus Rhagada, endemic to northern Western Australia, have relatively large, non-overlapping geographic ranges. In contrast, over much smaller distances in the Dampier Archipelago, several locally endemic, morphologically distinctive species occur, with intermingled ranges. To test alternative origins of the unusual local diversity, we compared allozymes at 21 loci in 12 archipelago populations and 14 mainland populations, representing 14 species. Genetic distances were consistently low, averaging 0.019 (range, 0.000 to 0.051) within species, and only 0.043 (0.001 to 0.133) between species. In the Dampier Archipelago, the average genetic distance between species was even smaller (0.023), indistinguishable from the within-species comparisons, and highlighting the disconnection between morphological diversification and levels of molecular genetic divergence. A pattern of isolation by distance among all comparisons within the archipelago also suggests a historic cohesiveness of the species in the Dampier Archipelago. Although providing no resolution of relationships among mainland populations, a neighbour joining tree provided further support for an in situ morphological radiation in the Dampier Archipelago, transcending variation seen over much larger distances on the mainland.
More than an artist: Olive Hornbook MacFarland's work to complete her husband's studies of opisthobranchiate mollusks of the Pacific Coast of North America Johnson, Rebecca F. Department of Invertebrate Zoology, California Academy of Sciences, 875 Howard Street, San Francisco, California, USA 94103 and Department of Ecology and Evolutionary Biology, University of California Santa Cruz, Santa Cruz, California, USA 95064. Email: rjohnson@calacademy.org Olive Hornbrook MacFarland is best remembered for the stunning color watercolors of live opisthobranchs which accompanied her husband Frank Mace MacFarland's studies of the opisthobranchs of the Pacific coast. Olive and Frank worked closely in the field, in the laboratory and iat the drawing board. They spent many a morning together tidepooling and hunting for new opisthobranch species. Olive took courses in Marine Biology and received her Master's degree from Stanford University, in part to help improve her illustrations. After Frank MacFarland died suddenly in 1951, Olive spent ten years assembling his beautiful treatment of the Pacific coast opisthobranchs. Together with his colleagues, she compiled all of his notes, drawings and a rough first draft of the monograph into the 550 page book, complete with 72 plates. I will present a brief history of Frank MacFarland's work and detail Olive MacFarland's contributions to that work.
Diseases of pearl oysters and other molluscs: A Western Australian perspective Jones, J. Brian* & Creeper, John Department of Fisheries, Government of Western Australia, P.O. Box 20 North Beach, WA 6920 Australia. Email: bjones@agric.wa.gov.au Mollusc culture, particularly the cultivation of pearl oysters, is an important component of the aquaculture industry in Western Australia. As a result there has been a long-term investment in surveys of commercial mollusc species for potential diseases of concern. A number of these potential pathogens within wild-stock shellfish have the potential to affect mollusc populations including haplosporidians, Bonamia sp. and rickettsia-like organisms. Others may pose risks if translocated in association with aquaculture activities. The microsporidan Steinhausia multilovum, which is found in ova of Mytilus galloprovincialis, poses intriguing questions about the origin and dispersal of its host.
High-resolution records of climate and life history in shells of the short-lived bivalve, Donax variabilis, from northeastern Florida, USA Jones, D.S.* & Quitmyer, I.R. Florida Museum of Natural History, University of Florida, Gainesville, FL 32611, USA. Email: dsjones@flmnh.ufl.edu The variable coquina clam, Donax variabilis, is one of the most familiar inhabitants of exposed sandy beaches along the Atlantic Coast of the USA, ranging from the Middle Atlantic States to southern Florida and around the Gulf Coast to Texas. Although today this species is not exploited commercially, extensive archaeological shell midden deposits along the northeastern Florida coast confirm that coquina clams were heavily exploited by pre-Columbian people since Middle Archaic times (ca. 5700 YBP). We examined the oxygen isotopic records of modern and archaeological Donax variabilis shells to assess seasonal growth and longevity in this species, and to determine if there was a seasonal component to shellfish harvest by indigenous peoples during the middle to late Holocene. Year-round collections of living clams and seawater data from Matanzas Beach, Florida, were made at monthly intervals and combined with historical temperature data to establish an environmental framework. The stable oxygen isotopic variation in two serially sampled, modern shells closely tracks the water temperature variation during the seasons of most rapid shell growth, spring and summer. In fact, the d 18O profiles are completely explained by seasonal water temperature variations. Shell edge isotopic values correspond with water temperatures at the time of collection. Similar d 18O profiles in four archaeological specimens from four different sites, representing two distinct time periods, indicate shell growth in late spring - summer, with harvest in autumn. Average longevity was 3-4 months. Paleotemperatures derived from two Preceramic Archaic specimens (ca. 5700 YBP) and two Orange Period specimens (ca. 3500 YBP) indicate warmer than modern temperatures by about 3.5° C, perhaps reflecting the mid-late Holocene thermal maximum in this region. Additional sampling of shells from other time horizons and localities will be needed to confirm these patterns.
Mate-choice and possible sperm trading in the hermaphroditic land snail Succinea putris (Pulmonata: Succineidae) Jordaens, K.*1, Pinceel, J,1 & Backeljau, T.1,2 1. University of Antwerp, Evolutionary Biology Group, Groenenborgerlaan 171, B-2020 Antwerp, Belgium. Email: kurt.jordaens@ua.ac.be 2. Royal Belgian Institute of Natural Sciences, Vautierstraat 29, B-1000 Brussels, Belgium Internally fertilizing hermaphroditic animals show a bewildering variety of mating behaviour and mechanisms and many species have reciprocal sperm exchange. When matings are frequent and costly, partners are expected to donate more sperm when they receive more sperm (i.e. sperm trading) but this has only been shown experimentally in sea slugs, free-living flatworms and possibly cestodes. This study addresses mate-choice and sperm trading in the hermaphroditic land snail Succinea putris. Mate-choice was random with respect to shell size. However, in matings where both partners were of unequal size, significantly more matings were observed where a small active individual mated on top of a larger inactive individual than the reverse. We suggest that this may be the result of mating on a vertical substrate or underneath a horizontal substrate where it is easier to carry a smaller individual than a larger individual. The number of sperm transferred during mating was highly variable (range: 0 – 6 392 000) and was not related to the size of the donor, the size of the recipient, the size difference between the two partners or mating duration. Twelve out of the 87 matings involved unilateral sperm exchange. There was a significant positive relation between the number of sperm donated by both partners. This suggests that sperm trading might take place in S. putris.
No effect of heavy metal contamination on the population genetic structure of the land snail Cepaea nemoralis (Pulmonata, Helicidae). Jordaens, Kurt*1, De Wolf, Hans2, Van Houtte, Natalie1, Vandecasteele, Bart3 & Backeljau, Thierry1,4 1. University of Antwerp, Evolutionary Biology Group, Groenenborgerlaan 171, B-2020 Antwerp, Belgium. Email: kurt.jordaens@ua.ac.be 2. University of Antwerp, Ecofysiology, Biochemistry and Toxicology, Groenenborgerlaan 171, B-2020 Antwerp, Belgium. 3. Institute for Forestry and Game Management, Gaverstraat 4, B-9500 Geraardsbergen, Belgium. 4. Royal Belgian Institute of Natural Sciences, Vautierstraat 29, B-1000 Brussels, Belgium. The genetic variability and allele frequencies of natural populations may change as the result from induced mutations, population bottlenecks, and selection caused directly or indirectly by contaminants such as heavy metals. In this study, we compared allozyme diversity in four polluted and four non-polluted populations of the land snail Cepaea nemoralis in Flanders (northern Belgium). Our study did not reveal any significant change in allele frequencies in polluted populations, neither changes in allelic diversity, observed or expected heterozygosity levels. Rather, genetic variation and population densities were high in all populations and gene flow estimates among the populations were very high suggesting no effects of recent bottlenecks and/or effects of strong genetic drift in the polluted populations.
Phylogeny of the subfamily Venerinae (Bivalvia: Veneridae) as inferred from morphology and molecules Kappner, Isabella 1. Department of Biological Sciences, University of Illinois at Chicago and Department of Zoology (Invertebrates), Field Museum of Natural History, 1400 S. Lake Shore Drive, Chicago, Illinois 60605, USA. ikappner@fieldmuseum.org The Venerinae (Heterodonta: Veneridae) is a diverse, commercially important, and cosmopolitan marine bivalve subfamily. Recent workers synonymized it with the subfamily Chioninae, due to its overall morphological similarity. The use of these traditional morphological characters alone, however, is questionable for resolving phylogenetic relationships of this group. To study these relationships a phylogenetic analysis was conducted on nucleotide sequences of the mitochondrial small subunit (16S) and the protein coding gene cytochrome oxidase subunit I (COI). 87 ingroup taxa were used from 21 venerine and chionine genera as well as 17 outgroup taxa of other venerid subfamilies. Alignments were analyzed using a Bayesian approach with Markov Chain Monte Carlo methods and maximum parsimony methods. The resulting phylogenetic hypotheses suggest that the Chioninae and Venerinae are discrete taxa. The former chionine genus Chamelea is now grouped within the Venerinae. Morphological features of the Venerinae s.s. are being re-analyzed in light of the molecular study to describe monophyletic entities. Sponsored by NSF-PEET DEB-9978119.
Seed production techniques of abalone Haliotis discus hannai based on larval and post-larval ecology Kawamura, Tomohiko1* and Takami, Hideki2 1. Ocean Research Institute, The University of Tokyo, Tokyo 164-8639, Japan. Email: kawamura@ori.u-tokyo.ac.jp 2. Tohoku National Fisheries Research Institute, Fisheries Research Agency, Miyagi 985-0001, Japan. Email: htakami@affrc.go.jp The culture techniques of abalone have been developed in the last 30 years and have made great advances. However, many abalone hatcheries around the world still suffer from low and inconsistent survival in the first few months post-settlement. This is due to low and variable settlement rates, and difficulty in keeping adequate quantity and quality of initial foods, which are usually benthic diatoms. The tolerance of newly metamorphosed post-larval abalone to starvation is extremely low and limited food over several days has a harmful effect on the survival of post-larvae. Post-larval growth and survival rates are considerably affected by diet and the ability of individuals to utilize available food.Hatcheries in northern Japan, which produce juvenile Haliotis discus hannai by the pre-grazed plate method, are going relatively well in comparison with hatcheries in many other countries. Survival rates from larva to 12 months, in the hatcheries in northern Japan, are usually from 10 to 30 %. Recent progress in understanding larval and post-larval ecology can explain scientifically the role of the pre-grazed plates for abalone. In this paper, we summarize key findings on larval and post-larval ecology of H. discus hannai, and evaluate the present seed production techniques in abalone hatcheries.
Biomphalaria straminea (Mollusca, Planorbidae) (Dunker, 1848): some stages of the embryonic development with Laser Scanning Confocal Microscopy. Kawano1, T, Watanabe2, L.C., Medeiros Y Araújo3, C.M., Nakano1, E., Caldeira4, W., Ribeiro4, A.F., & Spring5 H. 1. Laboratório de Parasitologia, Instituto Butantan, SP, Brasil. Email: toshie@butantan.gov.br 2. Departamento de Zoologia, IBUSP, Brasil. 3. Depto de Morfologia/Genética, UnB, Brasil. 4.Centro de Microscopia Eletrônica, USP, Brasil. 5.Deutsches Krebsforschungszentrum, Heidelberg, Germany. Biomphalaria straminea is a fresh water snail and one of the intermediate host of schistosomiasis in Brazil. This species can adapt in different habitats becoming an important public health problem. The main stages of the embryonic development were analysed with confocal microscopy. The fluorescent probe DiOC6 was used as vital stain in in vivo preparations, and for the fixed ones, the Feulgen reaction and Hoerchst for nuclei were used. Some results on the first cleavages, morule, blastula, gastrula, early trochophore, trochophore and veliger were presented, showing the importance of the investigation with confocal in the morphogenetic studies on mollusks embryos. Supported by FAPESP
Embryology of Biomphalaria sp. (Mollusca, Planorbidae): different methodologies. Kawano1*,T., Watanabe2, L.C., & Nakano1, E. 1. Laboratório de Parasitologia, Instituto Butantan, SP, Brasil. 2. Departamento de Zoologia, IBUSP, Brasil. Email: toshie@butantan.gov.br From ten Biomphalaria fresh water species occurring in Brazil, three are vector of Schistosomiasis: Biomphalaria glabrata, Biomphalaria tenagophila and Biomphalaria straminea. After the first study on the early development of B. glabrata, the two other species has been studied with different methodologies in order to determine the differences and similarities among them. The mollusks embryos have a spiral cleavage type with regular pattern, as observed in cell lineage studies with B. glabrata. The third cleavage in B. glabrata embryo is laeotropic, and the snail has the sinistral shell aperture. The cleavage pattern of the cephalic region in this species is very similar to other fresh water snails as Lymnaea stagnalis some cells from the head region stop dividing and form larval structures as apical plate and head vesicle, whereas other cells continue diving and form the cephalic plates, developing into adult structures such as eyes, tentacles and cephalic ganglia. With the Scanning Electron Microscopy, it was possible to visualize some important details on the B. tenagophila embryology, as the surface of the embryos or the assynchronic division of the third cleavage, for the first time observed. Biomphalaria straminea was studied with the Laser scanning Microscopy with whole mounting embryos demonstrating the right positions of the polar bodies, blastopore, stomodeum, shell gland, in optical slices. The fluorescent probe DiOC was used as in vital stain preparations, and the Feulgen reaction and the fluorescent probe Hoechst were used in the fixed ones. These results demonstrated the importance of each methodology to complete the morphogenetic knowledge, even with the same pattern of development. Also, it is very important to recognize the basic aspects of the normal embryonic development, because it will be possible to analyze the morphogenetic malformations induced by different agents. Supported by FAPESP.
Shell structures of gastropods from hydrothermal vents and seeps Kiel, S. Freie Universität Berlin, Institut für Geologische Wissenschaften, Fachrichtung Paläontologie, Malteserstrasse 74-100, 12249 Berlin, Germany. Email: steffen.kiel@gmx.de Shell structures of 24 gastropod species from hydrothermal vents and seeps are electron microscopically investigated, and the ecological and phylogenetic implications of their shell structures are outlined. The presence of prismatic complex crossed lamellar, and regularly foliated structure in the Neolepetopsidae provides further evidence for their position within the Acmaeoidea. The shell of Pyropelta musaica shows several layers of alternating simple prismatic and crossed lamellar structure. This alternating layering is unknown from other cocculiniform limpets, except for an Oligocene species from ancient cold-seep carbonates, which is therefore regarded as pyropeltid. The Lepetodriloidea are considered to be derived from, or to have a common ancestor with the Fissurellidae, based on their complex crossed lamellar structure and on the presence of shell pores. The earlier hypothesis that Peltospiridae derived from Neomphalidae by reduction of complex crossed lamellar structure can not be supported; both groups show the same array of shell structures. It is shown that shell pores are a frequent feature in Neomphalidae and Peltospiridae. The trend that small and thin-shelled gastropod groups tend to reduce their shell structure to intersected crossed platy, can also be observed in the vent/seep gastropods. Generally, the shell structures of vent/seep gastropods appear to reflect those of the phylogenetic group to which they belong, rather than being influenced by the peculiarities of the extreme environment they inhabit. An exception to this is that many species show a rather loose packing of the microcrystals. Such loose packing is rarely observed in species from non-chemosynthetic, shallow marine habitats.
Eocene and Oligocene cold-seep molluscs from Washington State, USA Kiel, Steffen* Freie Universität Berlin, Institut für Geologische Wissenschaften, Fachrichtung Paläontologie, Malteserstrasse 74-100, 12249 Berlin, Germany. Email: steffen.kiel@gmx.de Cold-seep carbonates in Eocene and Oligocene deep-water sediments on the Olympic peninsula in western Washington State yield a wealth of well-preserved molluscan fossils. Newly collected material revealed the first or geologically oldest fossil records of the extant vent and seep inhabiting genera Pyropelta and Lurifax (Gastropoda), and Bathymodiolus and Catillopecten (Bivalvia). New data on protoconch/prodissoconch morphology and/or shell structure are provided for Provanna antiqua, Retiskenea statura, and Bathymodiolus willapaensis. Three nuculanids show concentric and radial reticulation on the prodissoconch, which is currently known only from two extant vent-inhabiting nuculanids. The wrinkle-like appearance of the reticulations suggests that they are (at least partly) the result of shrinkage prior to the final calcification of the shell. The presence of a Bathymodiolus species in Oligocene cold-seep carbonates indicates that the split between vent/seep and whale/wood-fall inhabiting bathymodiolines took place at least 30 million years ago. Larval developmental strategies were inferred from protoconch and prodissoconch morphologies in fourteen species. They largely reflect those of the phylogenetic group to which the species belong, like in modern vent and seep molluscs. Healed shell injuries and presumed naticid drill-holes represent the oldest hitherto known records of predation in fossil cold-seeps.
Molecular phylogeography of the Patelloida profunda group (Gastropoda: Acmaeidae) Kirkendale, L. Department of Zoology & Florida Museum of Natural History, University of Florida, Gainesville, FL 32611 USA In the last decade, research has shown higher than expected levels of genetic structure in marine taxa perceived to have high dispersal abilities. The implication to conservation initiatives, specifically marine protected area (MPA) design, is that connectivity among such populations is less than previously thought. To date, low dispersal taxa have been little studied, but may function as the "lowest common denominators" in MPA design initiatives. We investigate phylogeographic patterns in the poorly dispersive, yet widely distributed, Patelloida profunda group and related congeners across the Indo-west Pacific region. 16S and COI mtDNA markers are used to circumscribe 12 reciprocally monophyletic lineages from 13 localities, increasing the number of independent lineages in the region. However, juxtaposed against this structure is genetic connectivity between two widely separated Indo-Malay P. profunda populations, a discovery that contrasts previous work in the same geographic arena. This finding strongly cautions against single taxon indicators for designing conservation priorities or marine protected areas (MPAs). Historical and/or biologic factors may play more significant roles than oceanography alone in determining the genetic makeup of a population. Divergence time estimations across major biogeographic boundaries suggest ancient divisions in the group in comparison to more recent breaks reported for other IWP groups across similar areas. Finally, in light of these findings, we discuss the difficulty in deriving biogeographic process from phylogenetic trees.
Evolution of photosymbiosis in bivalve molluscs (Bivalvia: Cardiidae) Kirkendale, L. Department of Zoology & Florida Museum of Natural History, University of Florida, Gainesville, FL 32611 USA In the marine clam family Cardiidae, two closely related subfamilies (Tridacninae and Fraginae) exhibit divergent morphological responses to a similar selective pressure- light capture for photosymbiosis. All giant clams maximize light capture via a similar suite of morphological characters, including mantle hypertrophy, pronounced valve gaping, and expansion of the posterior area. In contrast, the more diverse but poorly characterized Fraginae have travelled a much different route. Photosymbiotic taxa have responded to the same selective pressure of maximizing light capture by assuming a wide diversity of morphologies, including modifications to shell shape, shell size, shell microstructure and behavior. Three mitochondrial (16S, COI, CytB) and one nuclear (28S) gene regions were assembled to understand the relationships among over thirty photosymbiotic and non-photosymbiotic Fraginae taxa and key characters were then mapped onto this phylogeny. Briefly, I find evidence that 1) the Fraginae genera presently circumscribed are not monophyletic, 2) there has been a single origin of photosymbiosis and 3) there has been a single origin of certain novel characters important in photosymbiosis, including window shell microstructure.
Comparative study of the cephalic sensory organs in the Opisthobranchia Klussmann-Kolb, Annette*1, Staubach, Sid1, & Croll, Roger P. 2 1. Zool. Inst. der JW Goethe Univ., Siesmayerstrasse 70, 60054 Frankfurt am Main, Germany. Email: Klussmann-Kolb@zoology.uni-frankfurt.de 2. Dept. Physiol. & Biophys. Dalhousie Univ., Halifax, Nova Scotia, Canada B3H 4H7 The structure and function of the central nervous system of Opisthobranchia are well known, and these organisms are among the best studied invertebrates in this respect. However, the organisation and function of the peripheral nervous system in these animals is much less understood. Cephalic sensory organs (CSOs) show a great diversity in the different opisthobranch orders. They can be identified as cephalic shields, Hancock´s organs, lip organs, rhinophores or labial tentacles. CSOs are generally believed to have chemo- and mechanosensory functions. The overall morphology of these organs is well known, but details of the sensory epithelia and innervation patterns of these stuctures are much less studied. Moreover, questions of homologies of the different organs have never been addressed in detail before. For the first time a comparative study of the CSOs is being undertaken in representatives of the major opisthobranch orders. With the use of axonal backfilling techniques we will present preliminary data on the cellular innervation of different types of CSOs in "Cephalaspidea s. l". Moreover we use immunoreactivity to serotonin, FMRFamide and tyroxine hydroxylase in order to characterise the different sensory epithelia. Based on comparisons with other opisthobranchs (e. g., Aplysia, Berthella) we will discuss hypotheses regarding homologies and functions of different CSOs in different taxa. This will help us to eventually understand the evolution of these organs in opisthobranchs and by comparison with other gastropod taxa in gastropods in general.
The mitochondrial gene arrangement of two limid bivalves (Mollusca): Limaria hians and Lima inflata Knapp, Martina*1, Dreyer, Hermann2, & Steiner, Gerhard3 Department of Systematic Zoology, Institute of Zoology, University of Vienna, Althanstrasse 14, A-1090 Vienna, Austria. Emails: 1. a9909062@unet.univie.ac.at; 2. hermann.dreyer@univie.ac.at; 3. gerhard.steiner@univie.ac.at Mitochondrial genome organization has became a valuable marker for phylogenetic reconstruction in Metazoa. Contrasting the highly conserved mitochondrial gene order in Arthropoda and Vertebrata, Mollusca are extremely variable in this aspect. Of the 17 presently available molluscan mt-genomes, those of the polyplacophoran Katharina tunicata, the gastropod Haliotis rubra and the squid Loligo bleekeri most closely resemble that of other invertebrates. The Bivalvia contribute significantly to the variability sharing only few gene junctions with Katharina and Haliotis. The high rate of gene rearrangements and the small taxon sample for bivalves make the use of the mt-genome arrangement data difficult for phylogenetic inference. To better assess the phylogenetic signal in mt-gene order we sequenced 90% of the complete mt-genomes of two species of the pteriomorph family Limidae, Limaria hians and Lima inflata. In both species, all genes are encoded on the same strand and the gene for the ATPase-8-subunit is missing. Limaria hians possesses three putative copies of the tRNA-Val and two copies of each tRNA Phe and Cys, whereas Lima inflata features two tRNA-Pro genes. A putative origin of replication is located between nadh6 and cox1. The two limids have similar gene arrangements differing only in the position of nadh5 and the relative position of cox3 + nad3 to rrnS + rrnL (disregarding tRNAs). Comparison with other molluscan mt-genomes shows the limid gene arrangement more similar to that of the polyplacophoran Katharina tunicata and the gastropod Haliotis rubra than to other bivalves. However, the tree inferred from all protein coding gene sequences of all available molluscan, annelid and tentaculatan genomes supports Bivalvia as a monophylum. This result indicates that high rearrangement rates for mt-genes is not a common feature of the Bivalvia but may have originated several times independently in their evolutionary history.
Mating behaviour and reproductive characteristics in populations of the edible snail Helix aspersa differing in sperm competition intensity. Inheritance of the reproductive traits to the F1 generation Koemtzopoulos, Evripides* & Staikou, Alexandra Department of Zoology, School of Biology, Aristotle University, 54 124 Thessaloniki, Greece. Email: astaikou@bio.auth.gr The edible snail Helix aspersa belongs to the simultaneous hermaphroditic species, which are obligatory outcrossers. In this species multiple mating before oviposition is common leading to increased sperm competition intensity and providing significant reproductive benefits to the female function of the snails. In this study we report results on the relationship between mating behaviour (mating propensity, mating frequency, mating duration) and several reproduction characteristics (number and size of egg-layings, hatching success, survival of newly hatched snails during the first forty days of life), in snails from five populations from two regions differing in microhabitat characteristics and population density. To test inheritance of the traits studied our experiments were carried out in wild caught snails and in their descendants, which were raised in the laboratory. Mating behaviour differed among populations studied. Populations coming from dryer habitats showed higher mating frequency, leading to increased sperm competition intensity, and shorter mating duration than populations coming from more humid habitats. These traits were inherited since they were observed in both the P and the F1 generation. Within the same region population density played a minor role in determining sperm competition intensity. Also, our results showed that female fecundity depends on the size of the snail and the number of matings the animal has been engaged to (mating frequency) before oviposition in all the populations studied.
Kin recognition and comparison of inbreeding and outbreeding in populations of the edible land snail Helix aspersa
Koemtzopoulos, Evripides* & Staikou, Alexandra Department of Zoology, School of Biology, Aristotle University, 54 124 Thessaloniki, Greece. Email: astaikou@bio.auth.gr Land snail populations are characterized by restricted mobility of individuals; therefore the possibility of inbreeding in natural populations of cross-fertilizing species is relatively high. In an attempt to simulate field conditions, we tried to test if a behavioral mechanism to prevent mating between half siblings (kin recognition) operates in the obligatory outcrossing land snail Helix aspersa and if the offspring of such matings face inbreeding depression. The mating behaviour of half sibling snails (belonging to the same clutch) vs. unrelated snails was recorded in groups of six virgin snails (two triads of half siblings) in four different populations from Southern Greece (three from the area of Nafpaktos and one from Nafplion). Fecundity (number of eggs laid), fertility (the proportion of eggs that hatched) and survival of offspring were recorded in both inbreeding and outbreeding animals. The results showed random mating, therefore no kin recognition mechanism in two of the populations studied and selective mating for inbreeding avoidance in the other two. These contradictory results are probably due to the varying degree of relatedness of half-siblings in the populations used. Furthermore the microclimatic differences among the four populations could also be responsible for this contradiction, since random mating populations came from habitats with low plant cover, higher degree of aridity and greater exposure to sun. No difference between inbreeding and outbreeding animals was recorded in fecundity, fertility and survival of offspring in anyone of the populations studied.
Karyotypes of two species of the genus Cyclophorus (Prosobranchia: Cyclophoridae) from Thailand Kong-Im, Bang-On* & Panha, Somsak Mollusc Systematic Research Unit, Department of Biology, Faculty of Science, Chulalongkorn University, Bangkok10330, Thailand Email: bungonk@yahoo.com Cyclophorus volvulus (Muller, 1774) and C. malayanus (Benson, 1852) from Thailand were karyotyped. These species showed similarity in diploid chromosome number (2n = 28), but distinct intrageneric differentiation in haploid karyotypic arrangements of n = 14m in C. volvulus and n = 13m + 1sm in C. malayanus. Chromosomal variation was also recognized within C. volvulus animals collected from Sakhon-nakorn, Udon-thani and Khon-kaen had all 14 metacentric chromosomes. However, one submetracentric was obtained in specimens of C. volvulus from Lopburi. Comparatively C. malayanus collected from four localities in Surat-thani showed all 13m + 1sm. Furthermore, heteromorphic sex chromosomes (ZW type) were observed in C. volvulus collected from Sakhon-nakorn. Taxonomic and evolutionary implication of the present findings are discussed.
Preliminary analyses of macromolluscan diversity in central Great Barrier Reef soft sediments Kosnik, Matthew A. Centre for Coral Reef Biodiversity, Department of Marine Biology, James Cook University, Townsville, QLD 4811 Australia Although existing data for molluscs as well as better-known groups such as fishes and corals suggest the potential for important latitudinal and cross-shelf trends in community composition, spatial and temporal patterns in molluscan diversity on the Great Barrier Reef (GBR) are largely unquantified. This study begins to quantify differences in macromollusc community composition by examining two areas on the central GBR. Six preliminary bulk samples from the Whitsunday Islands and the Palm Islands are compared. Sediment grabs were collected from reef associated soft-sediments at a series of inshore reefs in each area. Macromolluscs were sieved from grab samples. Species richness and abundance patterns are compared among areas as well as between the Palm Islands and Whitsunday Islands using the molluscs from the >4 mm sieve fractions. Species accumulation curves similar for all of the samples, but also suggest that tenth of a meter-square area grab samples are not adequate to address the question. Approximately 55% of the species found occur in only one sample and 86% of the species occur in fewer than four of the samples. Gastropod richness and abundance is lower than expected (<1% of specimens and <20% of taxa sampled). Some compositional differences between sample areas will be discussed.
Diversity patterns of freshwater gastropods in lake habitats with and without anthropogenic disturbance in Lake Victoria, Kenya Lange, C. N1 , Kristensen, K.T.2 & Madsen, H.2 1. Department of Invertebrate Zoology, National Museums of Kenya, P. O. Box 40658 Nairobi, Kenya. 2. Mandahl-Barth research center for Biodiversity and Health, Danish Bilharziasis Laboratory, Jaegersborg Alle’ 1D, 2920 Charlottenlund, Denmark. We present the findings of a study to investigate the diversity patterns of freshwater gastropod in habitats with and without anthropogenic disturbance in L. Victoria, Kenya. The study was implemented at disturbed fishing beaches and sites least disturbed by human using different standardized snail sampling methods. A total of 15 species and 133984 specimens were recorded. One species (Physa acuta) was a new record to Lake Victoria and an invasive species. Comparatively higher snail diversity was reported from the undisturbed habitats than in the disturbed habitats, though the disturbed habitats presented a higher snail abundance overall. Three species were only recorded from undisturbed habitats whereas one was only reported from the disturbed habitats. The rest of the species also showed tendency to be associated with one kind of habitat. Those acting as intermediate hosts in snail borne diseases showed a higher preference to the disturbed habitats compared to the least disturbed habitats. The study portray that anthropogenic disturbances are likely causing decline of the regional freshwater gastropods creating a conservation concern. Secondly such influences are resulting in build up of high densities of potentially intermediate hosts of schistosomiasis and fascioliasis thereby increasing risks of transmission of potential snail borne diseases. In this regard, increased conservation effort of Lake Victoria is recommended to promote conservation of the regional gastropod biodiversity and control risks associated with transmission of the potential snail borne diseases.
Effects of algal concentration and temperature on the feeding rates at three life stages (Larva, spat, adult) of the Purple Clam, Saxidomus purpuratus Lee, C.-H.*, Ryu, T.-K., Sung, C.-G. Seo, J.Y. & Choi, J.W. South Sea Institute, KORDI, Geoje 656-830, Republic of Korea. Email: leech@kordi.re.kr The purple clam, Saxidomus purpuratus is a local species inhabiting relatively restricted areas around Korea, Japan, and China. Recently, the commercial yield from the traditional exploitation of natural fisheries by divers has been declining due to over-harvesting. Much attention has been concentrated to the aquaculture and restocking of this species. The purpose of this study was established to know the feeding rates and to determine optimal ration level for each life stage of S. purpuratus. Experiments were carried out to know the clearance rate (CR) and ingestion rate (IR) as functions of algal concentration and temperature of each stage using Isochrysis galbana. At all three stages, algal concentration strongly affected CR. With increasing algal concentration CR increased rapidly, but after a certain threshold level it decreased gradually. IR was also affected by algal concentration. In the experiments with larvae and spats, the changing pattern of IR could be divided into two phases: (1) as algal concentration increased with low level, IR increased rapidly, (2) but, as algal concentration increased further, IR did not increase any more. However, in the experiments with adults, IR increased continuously. For rearing larvae and spats with better nutritional conditions, algal concentration should not be less than 1.6×104 cells/ml for larvae and 7.0×105 cells/ml for spats. As for temperature, maximum IR in spats of S. purpuratus increased when temperature increased from 5 to 25°C, but it was lowest at 30°C. Between 15 and 25°C the IR was most stable. At this temperature range, the Q10 was 1.6. To acquire fast growth of spats in inland culture during winter, it is necessary to maintain water temperature over 15°C.
Ribbed mussels of the Caribbean: the curse of the sibling species complex Lee, Taehwan* & Ó Foighil, Diarmaid Museum of Zoology and Department of Ecology and Evolutionary Biology, University of Michigan Ann Arbor, Michigan 48109-1079, USA. Email: taehwanl@umich.edu
The inter-tidal "scorched" mussel Brachidontes exustus (Linné, 1758) is nominally distributed along a continuous coastline from North Carolina to Venezuela and is also present on nearby continental (Greater and Lesser Antilles, Bahamas) and oceanic (Bermuda) islands. This regional evolutionary landscape has experienced a dynamic recent geological history that has reconfigured continental and oceanic interfaces. We were interested in establishing what imprint these events may have had on Caribbean Basin scorched mussel cladogenesis and have constructed mitochondrial and nuclear gene trees based on hundreds of individuals sampled throughout the Basin and incorporating potential geminates from the eastern tropical Pacific. Gene tree topologies consistently recovered 3 stem Caribbean lineages and 5 well-differentiated terminal clades, which represent 5 regional sibling species. The cladogenic origins of the stem lineages predate closure of the Isthmus of Panama, whereas those of at least 3 of the 5 sibling species post-date closure. Caribbean sibling species have an intriguing pattern of within-Basin distribution characterized by distinct geographic areas of ecological dominance adjoining those of sister taxa. However, species are not restricted to their core distributional areas and may be encountered (often co-occurring in low frequency with the local dominant) in other parts of the Basin. These observations, coupled with the maintenance of genetic cohesion among geographically disjunct populations, imply that sibling species distributional limits are maintained by ecological factors rather than by barriers to larval-mediated gene flow. Our data are consistent with a history of geographically-partitioned within–Basin cladogenesis that has been largely maintained by environmental exclusion.
Molecular phylogeny of molluscan hemocyanin – a current perspective Lieb, Bernhard and Markl, Jürgen Johannes Gutenberg University, 55099 Mainz. Germany. Email: lieb@uni-mainz.de; markl@uni-mainz.de We have cloned and sequenced eight complete cDNAs encoding molluscan hemocyanins: two isoforms, respectively, from Haliotis tuberculata (Vetigastropoda), Megathura crenulata (Vetigastropoda) and Nucula nucleus (Bivalvia), and single hemocyanins from Aplysia californica (Opisthobranchia) and Nautilus pompilius (Cephalopoda). In addition, the complete hemocyanin cDNAs from Sepia officinalis (Cephalopoda) and Octopus dofleini (Cephalopoda) are available. Partial hemocyanin sequences could be obtained, or are available, from Nautilus macromphalus (Cephalopoda), Rapana thomasiana (Neogastropoda), nine other abalones (Haliotidae), three other sea hares (Aplysidae), two vineyard snails (Helicidae), and two chitons (Polyplacophora). In total, 33 hemocyanin sequences from 24 different molluscan species were used for multiple sequence alignment and phylogenetic tree construction. We were unable to obtain a statistically firm branching order of the different molluscan classes, but within these classes the deep phylogeny is well supported. For instance, within the Gastropoda, a bifurcation into Vetigastropoda and Heterobranchia occurs, and within the latter the division into the Pulmonata and Opisthobranchia emerges very clearly. Also, within the Cephalopoda, the classical branching order is well supported, with the nautilids branching off at a relatively basal position. Our studies of the two gastropod families Haliotidae and Aplysidae yielded, at the hemocyanin cDNA level, a 99.5% sequence identity. Therefore, intron sequences from the respective hemocyanin genes were successfully included to analyze the branching order, although the two trees remain unrooted. We still lack useful outgroups, because our other molluscan hemocyanin sequences are too remote for this purpose. Two different hemocyanin isoforms were detected in many of the molluscs studied. According to our molecular clock estimations, many of these gene duplication events occurred independently, and interestingly, several of them happened quite recently (10-40 MYA), whereas several others are very old (320-340 MYA). The new data further substantiate our previous finding that the molluscan hemocyanin as a whole evolved in the late Precambrian, ca. 740 MYA. Supported by the DFG (Ma 843 and Li 998).
Disturbance and snail diversity in the Kinabatangan Valley, Sabah, Malaysia
The effect of disturbance to snail diversity was examined at 7 limestone outcrops within the Lower Kinabatangan Valley, Sabah.At each site, at least two study plots with contrasting forest types were chosen. The disturbed sites have more ground plants and less canopy cover, secondary forest has more leaf litter than logged primary forest and primary forest. Snails were collected by direct search and from soil samples in 20 m x 20 m plots. A total of 18,552 individuals of 75 species were collected. Cluster analysis for all plots, using absolute numbers and Pulmonata and Prosobranchia snails separately, demonstrated that highly disturbed plots have shared snail assemblages. However, for the remaining slightly disturbed or undisturbed plots, both Pulmonata and Prosobranchia snails showed endemism and did not differ in species composition. Pulmonata snails from secondary forest are more diverse than in the logged primary forest, but they do not show different diversity in logged primary forest and primary forest. Indicator species analysis demonstrated that Lamellaxis gracilis and Kaliella angulata are good indicators for secondary forest. The Lower Kinabatangan region supports at least 30 % of the snails that have been recorded for Sabah. Severe disturbance cause the dominance of Kaliella sp., Microcystina sp. and Lamellaxis gracilis but slight disturbance did not change the endemism of snails too much. The decrease in dominance of Prosobranchia appears to result from reduced moss cover on rocks in disturbed forest, because most Prosobranchia in this study are rock-dwellers. Beside that, logging on limestone hill did not cause higher runoff and nutrient depression of soil does not affect Pulmonata, which mostly are ground dwellers. Both Lamellaxis gracilis and Kaliella angulata have a wide tolerance to environmental fluctuations and they are widespread species. Given the degree of endemism and species richness of snails in this region, and the possible decrease of Prosobranchia snails, all the limestone outcrops that still can be recovered must be conserved.
Are the living patellogastropods sister taxa? Lindberg, David R. University of California, Berkeley 94720, CA USA. Email: drl@Berkeley.Edu Since their formal inception as a taxon, the Patellogastropoda have been in a constant state of winnowing. First, it was the removal of the taxa with holes and notches, followed by taxa with lungs, posterior apices, and then some more that had rhipdioglossate radula. In some cases both the shell and soft parts were informative to the process of removal, in other cases it was only the internal anatomy. Today we are left with two main groups of Patellogastropoda – the patellids (e.g., Patella, Cellana, Nacella) and the acmaeids (Acmaea, Lepeta, Lottia). However, there remains substantial numbers of anatomical, molecular, and ecological autapomorphies that pose difficult explanations and evolutionary scenarios when they are forced to be derived from a most recent shared common ancestor. Alternatively, these autapomorphies could represent apomorphies found in different lineages of Paleozoic taxa that convergently became secondarily flatten, and because of the extinction of most of the these coiled lineages, two of the surviving lineages have been mistakenly grouped by the overweighting of the limpet shell as the primary synapmorphy. Pleisomorphic characters shared by shared Paleozoic ancestors would have included the docoglossate radula, pericardium-gonad-kidney configuration, and prismatic-foliated-crossed lamellar shells, protoconch morpohology, and paired ctenidia. Subsequent, divergence in these coiled ancestors established shell, radular, anatomical, and genomic apomorphies in these lineages prior to their giving rise to limpet-like taxa. Living patellid anatomy suggests that their ancestral lineage was more bilaterally symmetrical than that of the acmaeids. Ecological and molecular sequence data does not falsify the alternative scenario.
Gastropod phylogeny: An overview of the hypotheses, patterns, and predictions Lindberg, David R.1* & Ponder, Winston F.2 1. University of California, Berkeley 94720, CA USA. Email: drl@Berkeley.Edu 2. Australian Museum, Sydney, NSW 2000, Australia. Email: wponder@bigpond.net.au
Our current understanding of the phylogeny of the Gastropoda is almost twenty years old. New character and analytical analyses, combined with comparative studies, have produced new alignments of taxa that have both invigorated and vexed malacologists. However, outside of our community our work appears to have had little import, and instead traditional classifications, just-so-stories, and mistakes dominate in the literature. Over the last several years new morphological datasets have been initiated and some older data sets have been re-examined with new techniques. Several highly promising character databases (e.g., ultrastructure) have failed to expand beyond a handful of original practitioners. Molecular phylogenies have appeared and span a tremendous range of lineage scales and molecular markers. Molecular phylogenies have provided important insights into gastropod relationships, but the backbone of the gastropod phylogeny remains problematic regardless of data type. Progress has been made identifying putative outgroups – the Cephalopoda and Scaphopoda. Gastropod phylogeny has been featured prominently in both evolutionary developmental and genomic studies, and gastropod torsion has seen renewed research interest in the last 15 years. There has also been a re-examination of the evolution of the gastropod pallial cavity, and chromosomal data provides surprisingly good coverage across the gastropod tree. After nearly 100 years of inattention, researchers have also revisited the relationship between the patterns of cell lineage formation and gastropod phylogenetic relationships. Fossil data continues to provided important temporal benchmarks for the minimum appearance of morphological characters on the tree, and here again the application of analytical tools is providing new understanding of fossil morphologies. There remains much to be done. While many clades are well defined and branching patterns stable, many others are poorly supported, typically because of under sampling. There remains much to do with trees as well, including the exploration of striking parallelism in ecological and morphological characters that exist across the group.
A combined analyses approach to the evolution of the Cephalopoda Lindgren, Annie R., & Nishiguchi, Michele K.* Department of Biology, New Mexico State University, Box 30001, MSC 3AF, Las Cruces, NM 88003-8001 USA. nish@nmsu.edu This study provides a comprehensive phylogenetic analysis of the Cephalopoda (Mollusca) using molecular and morphological data. Four molecular loci (nuclear 18S rRNA, fragments of both 28S rRNA and histone H3, and mitochondrial cytochrome c oxidase subunit I) were combined with 101 morphological characters to test interfamilial relationships of sixty cephalopod taxa, with emphasis on the families within the superorder Decabrachia. Individual and combined data sets were analyzed using the direct optimization method, with parsimony as optimality criterion. Analyses were repeated for twelve different parameter sets accounting for a range of indel/change and transition/transversion cost ratios. Most analyses support monophyly of Cephalopoda, Nautiloidea, Coleoidea and Decabrachia, however the monophyly of Octobrachia was falsified due to the lack of support for a Cirroctopoda + Octopoda relationship. When analyzing all molecular evidence in combination or for total evidence analyses, Vampyromorpha formed the sister group to Decabrachia. Morphological data alone supported a sister relationship between Vampyromorpha and Octobrachia. Within Decabrachia, a relationship between the sepioid orders Idiosepiida, Sepiida, Sepiolida and the teuthid family Loliginidae was supported, rendering the order Teuthida polyphyletic. Relationships within the Decabrachia were highly parameter-dependent.
Quantifying preservational bias in molluscan death assemblages from the Chesapeake Bay: Can Holocene assemblages be used as a standard for ecological restoration? Lockwood, Rowan*, Work, Lauren A. & Chastant, Lisa R. Department of Geology, College of William and Mary, P.O. Box 8795, Williamsburg, VA 23187 U.S.A. Email: rxlock@wm.edu
Years of over-fishing, combined with increased nutrient pollution, have had a catastrophic effect on Chesapeake Bay ecology. The Holocene record of Bay molluscs may provide a baseline for ecological restoration, but the effects of preservational bias on these assemblages must first be assessed. In this study, we carried out a live-dead assemblage comparison on four sites located in the main channel of the Bay. Questions addressed include: (1) how well do death assemblages record the species composition, richness, and abundance of live communities? (2) what forms of shell damage occur in molluscan death assemblages? and (3) does damage differ according to shell mineralogy, life habit, or geographic location? Death assemblage data were obtained from replicate samples, which were collected by box core, sieved into four fractions, and stored temporarily in formalin. Whole specimens and fragments were sorted, identified to species level, and assigned taphonomic damage states. Data on the following taphonomic variables were collected: (1) bioerosion, (2) encrustation, (3) periostracum loss, (4) predatory drilling, (5) disarticulation, (6) fragmentation, (7) fine-scale alteration, (8) and edge-modification. Twenty years of live community data were provided by the Chesapeake Bay Program for the same sites. Preliminary results indicate that 83% of the species in the live community were also found in the death assemblage and 90% of the individuals of species found in the death assemblage were also found in the live community. The most prevalent forms of shell damage were periostracum loss, disarticulation, fragmentation, edge-modification, and fine-scale alteration; however, damage did not differ according to mineralogy or life habit. These results are preliminary, but they do suggest that Holocene molluscan assemblages may provide insight into the "natural" state of Chesapeake Bay communities.
Using nested clade analyses for determining species boundaries in three Indo-west Pacific Euprymna species Lopez, Josue, & Nishiguchi, Michele K.* Department of Biology, New Mexico State University, Box 30001, MSC 3AF, Las Cruces, NM 88003-8001 USA. Email: nish@nmsu.edu The sepiolid squid-Vibrio mutualism is an excellent system for examining mechanisms of cospeciation and host tracking patterns among a wide variety of symbiotic squid species. Currently, we are using genetic diversity and nested clade analyses to look at the variation between three allopatric Euprymna squid species: Euprymna scolopes (Hawaii), E. hyllebergi (Thailand), and E. tasmanica (Australia). Using four molecular loci-three mitochondrial (cytochrome c oxidase subunit I, 12S, and 16S rRNA) and the nuclear ribosomal Internal Transcribed Spacer Region (ITS), we have determined the genetic relatedness of these species in the Indo-west Pacific as well as the phylogeography and fixation indices between populations. This information will later be combined with data from symbiont populations of Vibrio biovars, in order to determine if host speciation influences symbiont evolution.
Gene conservation and early ontogenesis in molluscs Lynch, Sharon M. Museum of Paleontology, University of California, Berkeley, USA. Email: smlynch@uclink.berkeley.edu While it is clear that the same molecular foundations are used during animal development, how these developmental pathways were adapted to lead to diverse molluscan forms is still uncertain. Beneath the morphological diversity of phyla lies a unity of signaling pathways needed to generate them. Looking at the conservation of these regulatory pathways might provide insight into molluscan evolution. While molluscs make up the second largest animal phyla, most of the regulatory gene pathways used to determine the complex forms are still unknown. I am interested in deciphering the early developmental pathways in the gastropod, Ilyanassa obsoleta. I have isolated developmental regulatory genes in Ilyanassa and studied their expression using in situ hybridization. By comparing Illyanassa’s expression patterns in relation to other phyla, I hope to clarify how these regulatory genes remain conserved while enabling molluscan evolution. With the removal of the polar lobe produced during the trefoil stage of development, Ilyanassa will continue to develop with the loss of derivatives from the D quadrant, as well as other structures. Since Ilyanassa undergoes determinant cleavage, by choosing genes suspected to be active in the D quadrant, I hope to elucidate gene pathways leading to organogenesis. I will also discuss other research that has been done in early developmental stages of molluscs with the hopes of obtaining a clearer picture of early molluscan development in general.
Simple spades or sophisticated shovels – the fine structure of chiton teeth
Macey, D.J.*1, Brooker, L.R.1,3, Wealthall, R.J.2, & Griffin, B.J.2 1 Division of Science and Engineering, Murdoch University, Murdoch, WA 6150, Australia2 Centre for Microscopy and Microanalysis, University of Western Australia, Nedlands, WA 6907, Australia3 University of the Sunshine Coast, Maroochydore DC, Qld 4558, Australia. email: d.macey@murdoch.edu.au
A range of scanning electron microscopes has been utilized to undertake a detailed in situ investigation of the fine structure of the major lateral teeth of the chiton Acanthopleura echinata. These teeth are composite structures comprising three distinct mineral zones: a posterior magnetite layer; a thin band of lepidocrocite just anterior to this; and apatite throughout the core and anterior regions. Biomineralization in these teeth is a matrix-mediated process, in which the minerals are deposited around a complex series of fibres. The arrangement of the organic and biomineral components of the tooth is similar throughout the three zones, having no discrete borders between them, and with crystallites of each mineral phase extending into the adjacent mineral zone. Along the posterior surface of the tooth, the organic fibres are arranged in a series of fine parallel lines, but just within the periphery their appearance takes on a "fish scale"-like pattern, reflective of the cross section of a series of units that are overlaid, and offset from each other, in adjacent rows and separated by organic fibres. Two types of subunits make up each "fish scale"; one of which is elongate and curved, and forms a trough, in which the other, rod-like unit, is nestled. Adjacent units are aligned into large sheets that define the fracture plane of the tooth. The alignment of the plates of rod-trough units is complex and exhibits extreme spatial variation within the tooth cusp. Close to the posterior surface, the plates are essentially horizontal, and lie in a latero-medial plane, while anteriorly they are almost vertical and lie in the postero-anterior plane. An understanding of the fine structure of the mineralized teeth of chitons, and of the relationship between the organic and mineral components, provides a new insight into biomineralization mechanisms and controls.
Effects of domestic sewage on freshwater mollusc composition and abundance in three tropical streams in the "Parque Estadual da Pedra Branca, RJ, Brasil". Magalhães-Fraga, Sandra A., Braun, Bianca S., Santos, Sonia B.*, Moulton, Timothy P., & Barbosa, Francisco A.R. Lab. de Malacologia, Universidade do Estado do Rio de Janeiro, Rua São Francisco Xavier 524, Maracanã, CEP: 20550-900, Rio de Janeiro, Brasil. Email: sbsantos@uerj.br We studied here the freshwater snails as one of the results of a project about the relationships between biodiversity and ecosystem functioning in tropical urban streams by means of the role of the associated fauna and the effect of sewage pollution on the process of leaf-litter decomposition, using exclusion experiments. It was carried out in three lightly impacted urban streams in the park "Parque Estadual da Pedra Branca, RJ". Three experiments were placed above and three below the first domestic sewage pollution source in each river, in October-November 1999 and March-May 2000. All three streams arise in well-protected forest, but suffer pollution by domestic sewage as they leave the park. Seven gastropods and one bivalve were found: Heleobia sp. (Hydrobiidae), Melanoides tuberculatus (Müller, 1774) (Thiaridae); Physa cubensis Pfeiffer, 1839 (Physidae); Antillorbis nordestensis (Lucena, 1954) and Biomphalaria tenagophila (d'Orbigny, 1835) (Planorbidae); Gundlachia ticaga (Marcus & Marcus, 1962) and Ferrissia sp (Ancylidae) and, Pisidium puntiferum (Guppy, 1837) (Sphaeriidae). Richness was higher in 1999 (R=7), in Rio Grande and Rio Pequeno, in the two sites (impacted and not impacted). B. tenagophila and P. punctiferum, found in small densities in 1999, were absent in 2000, perhaps because of the negative effect of M. tuberculatus. Individuals were more abundant in 1999 (n= 4684, 94% in the impacted sites, being 85,9% of the total P. cubensis and 3,96% M. tuberculatus) than in 2000 (n= 2126, 75,2% in the impacted sites, being 8,7% of the total P. cubensis and 58 % M. tuberculatus). The reduction of P. cubensis, could be assigned to decreasing of pluviometric indices, waterflow and depth and increasing in temperature and M. tuberculatus population. There were less individuals in 2000 in the not impacted sites, but the difference was not significant, except to the Rio Engenho Novo where we found less individuals in 1999 than in 2000, explained by the massive presence of Heleobia sp (93,9% of the total number in 2000 in the not impacted sites). In general, impacted sites of the streams in all experiments show higher number of snails, confirming that domestic sewage contributes to decreasing the diversity and increasing the population abundance.
Decline and extirpation of unionids in a large Irish lake invaded by zebra mussels: a typical European experience? Maguire1*, C.M., Rosell, R.2 & Roberts, D.3 1. Aquatic Systems Group, Queens University Belfast, Agricultural and Environmental Sciences Division, Newforge Lane, Belfast, BT9 5PX. Email: c.m.maguire@qub.ac.uk 2. Department of Agriculture and Rural Development (NI), Agricultural and Environmental Sciences Division, Newforge Lane, Belfast, BT9 5PX. 3. School of Biology and Biochemistry, Queens University Belfast, Medical Biology Centre, 97 Lisburn Road, Belfast. Freshwater bivalves are threatened and declining globally. Widespread habitat degradation has been the primary cause of extinction but now unionid populations are under additional stress as a result of zebra mussel invasions. The zebra mussel (Dreissena polymorpha) is a recent addition to the Irish fauna. Documented cases showed that zebra mussels would probably have a major impact on native unionid species. Linear regression models used to predict infestation and impact on unionids in North America were used to predict impacts in Ireland. Baseline data on the distribution, density and biomass of the Anodonta population in Lough Erne were collected. Colonisation of the Anodonta population by zebra mussels was documented and the resulting impact was determined. Colonisation of the unionid population was rapid and there was a decline in unionid density, biomass and condition. The impact on unionids in Lough Erne was compared to other European and North American case studies. All indications are that the impact on native unionid populations in Ireland is different to the typical European experience. The long term survival of unionid populations is unlikely in Irish lakes invaded by zebra mussels due to zebra mussel fouling impacts, competition for food and the resulting decline in condition. However, complete extirpation may take 7-8 years, longer than in most North American waterbodies.
Performance of triploid Pacific oysters (Crassostrea gigas), produced from diploid or tetraploid broodstock, in cool and warm temperate growout sites in Australia Maguire, Greg B1,2*, Nell, John A3, Thomson, Peter A1,4, Kent, Greg N1 & Gardner, Caleb1 1 Tasmanian Aquaculture and Fisheries Institute 2 (Present address), Research Division, Department of Fisheries, PO Box 20, North Beach, WA 6920, Australia. Email: gmaguire@fish.wa.gov.au 3 NSW Fisheries, Port Stephens Fisheries Centre, Private Bag 1Nelson Bay, NSW 2315, Australia 4 (Present address), CSIRO Marine Research, GPO Box 1538, Hobart, Tasmania 7001, Australia Relative growth rates of triploid and diploid oysters could be influenced by method of triploid induction and by water temperate and food availability during growout on inshore leases. Triploid Pacific oysters and Sydney rock oysters (Saccostrea glomerata) oysters (3N), produced from diploid (2N) oysters by blocking the second polar body of eggs (2N eggs) after addition of sperm (1N), grew much faster than diploid oysters in warm temperate sites in Japan and New South Wales, Australia that were considered to have favourable natural food densities. However, the growth advantage for similar triploid Pacific oysters was both delayed and lower at three cool temperate sites in Tasmania, Australia two of which had favourable natural food densities. At two warm temperate sites in South Australia, where natural food densities can be limiting, large growth rate advantages were still not evident for triploid Pacific oysters. Blocking of polar body 1 in triploid females with unusually high levels of gonad development produced tetraploid (4N) offspring after addition of sperm (1N) from diploid males. Crossing tetraploid males with diploid females produced predominantly triploid Pacific oyster offspring. In New South Wales this led to a huge size advantage over diploid oysters during Growout whereas, in Tasmania, growth rates at the only site used varied for individual pair crosses and only one of four triploid lines grew rapidly.
The systematics and evolution of Bullidae (Gastropoda: Opisthobranchia)
Malaquias, M.A.E. & Reid, D.G. Department of Zoology, The Natural History Museum, London SW7 5BD, UK. Email: manm@nhm.ac.uk
The study of evolution and speciation of tropical marine invertebrates is still at an early stage, with many questions unanswered. Several hypotheses of speciation have emerged, differing in their emphasis of vicariant or dispersal events, speciation in sympatry or allopatry, and geological time scale. Bubble shells (Bullidae) are a small, worldwide family of gastropods with predominantly tropical distribution, but with a few species also present in temperate waters. These attributes make this group an excellent case study to evaluate patterns of biogeography and evolution on a global scale. Nevertheless, the use of Bullidae as a model requires first a comprehensive systematic revision of the group, since the taxonomy is extremely confused with over 100 available species names of Bulla. This project is the first attempt to incorporate data on shells, anatomy and molecular sequences of all available living species of Bullidae in a phylogenetic and biogeographic analysis. The main objectives are to produce a species-level phylogeny as a basis for hypotheses of evolutionary radiation, adaptation and biogeography, and to review and clarify the taxonomy. The preliminary molecular trees are consistent with the monophyly of Bullidae, and with the presence of an Indo-West Pacific clade. Morphological characters are both variable within species and similar among them, and none proved to be alone good enough for species diagnosis. Shells and reproductive structures are the most informative, but different sources of information must be combined in order to delimit species. Overall 18 species of Bulla are recognized: 3 in the Atlantic and Mediterranean, 13 in the Indo-West Pacific, and 2 in East Pacific. A peak of diversity occurs in the Indo-Malayan area where the distributions of 6 species overlap. This pattern suggests isolation between the Atlantic and the Indo-Pacific after the closure of the Tethys Sea during the early Miocene, followed by species radiation.
Variations in the penes and gonads of four species of the genus Oliva (Gastropoda: Olividae) from the Philippines Manalo, I.A.*, Dela Paz, R.M. & Vallejo, B.M. De La Salle University, 1204 Taft Ave. Manila 1004, Philippines. Email: manaloi@dlsu.edu.ph Collections of olive snails from two different localities in the Philippines − Talin Bay, Lian, Batangas and Ragay Gulf, Guinayangan, Quezon − yield four species tentatively identified as O. elegans Lamarck 1811, O. reticulata Röding 1798, O. tigridella Duclos 1835, and O. vidua Röding 1798. All the four species were identified from the Talin Bay collection, and one species, O. tigridella, from the Ragay Gulf collection. The penes of all the 35 male samples (O. tigridella, Ragay Gulf: n=12; O. tigridella, Talin Bay: n=4; O. elegans: n=9; O. reticulata: n=6; O. vidua: n=4) were examined. The four species differ in the external form of the penis. The mean penis length of O. tigridella (Talin Bay samples) is significantly different from O. tigridella (Ragay Gulf samples) and O. reticulata, at the 0.05 level. However, no significant difference is noted in the mean penis width among the four species. Histological analysis of the penis, one sample per species, shows basically similar structure of the vas deferens in transverse sections, lined with brush-like aggregate of sperm. The four species show minimal variations in the thickness of the vas deferens wall and size of its lumen. Sections of the distal region show large nucleated but short flagellated sperm, while sections of the proximal region show long flagellated sperm cells. Histological analysis of the testis shows seminiferous tubules with sperm at different stages of development only in O. tigridella Ragay Gulf. Similar structures, however, are not noted in any of the samples of the four species from Talin Bay, which show only tubules with granular contents and dark-stained nuclei. Sections of the ovary show clusters of eggs in all the samples studied, but remarkably larger eggs were observed in O. tigridella from Ragay Gulf. Taxonomic potentials of the characters studied are discussed.
Veliger culture, histology and population genetics of several species of nudibranch common to Mumbles, Swansea, UK (with notes on Akera bullata development). Marshall, Helen C.*, Facey, Paul D., & Hayward, Peter J. School of Biological Sciences, University of Wales Swansea, Singleton Park, Swansea, SA2 8PP, Great Britain. Email: 202934@swansea.ac.uk
The enigmatic nudibranch Thecacera pennigera is common at Mumbles, Swansea, UK. Veliger culture was successful to stage three, however, metamorphosis failed. The lecithotrophic Akeroida Akera bullata veligers were reared successfully through metamorphosis to young adults. Experiments showed they did not require a specific cue for settlement. The presence of a biofilm or Chondrus crispus was most successful in inducing metamorphosis. Long-term survivorship of the juvenile "adult" form was dependent upon the presence of a settlement substratum (either Ulva lactuca, Chondrus crispus, or Furcellaria lumbricalis) and a species of phytoplankton (either Tetraselmis sp., Isochrysis sp., Rhinomonas sp., or Chaetocerous sp.), despite the lack of feeding on all substrata except U. lactuca. Veliger development in several other species of nudibranch has also been observed, although none reached a stage competent to metamorphose. Histological studies were preformed on T. pennigera, Palio nothus, Ancula gibbosa and Facelina auriculata. The internal anatomy of Ancula had yet to be described until now. Spermatogenesis and oogenesis was seen in detail in all of the species studied. Population genetics of T. pennigera is currently under investigation. Two populations have been found in Wales at Mumbles and Pembroke. The mitchondrial CO1 gene was amplified using PCR and then sequenced.
‘Through the Keyhole’-When symmetrical, does the size of one’s body really matter?
Martin, Claire-Louise1, Simpson, Rodney D. 1, & Ponder, Winston F. 2 1. University of New England, National Marine Science Centre, PO Box J321, Coffs Harbour, NSW 2450, Australia 2. The Australian Museum, 6 College St. Sydney, NSW 2010, Australia The fissurellids (Vetigastropoda: Mollusca) are bilaterally symmetrical limpets. They are known as keyhole or slit limpets due to a hole or slit either at the apex or anterior margin. The mantle cavity of fissurellids contains paired ctenidia, osphradia and hypobranchial glands. Interestingly, the fissurellids are the only gastropods in which all mantle organs are paired and a symmetrical arrangement within the mantle cavity is maintained. Like most vetigastropods, fissurellids also have paired auricles, gonads, kidneys and the digestive tract and nervous system are crossed. Paired organs are not found in any of the other groups of uncoiled limpet-shaped gastropods. Even the sister group to other gastropods, the patellogastropods (true limpets) have asymmetrical organs with highly modified mantle cavity arrangements. Not only is the plesiomorphic mantle cavity arrangement in fissurellids unusual for gastropods, there is also a great size variance within the group. My research aims to test hypotheses about the popularly perceived notions regarding the inefficient nature of a symmetrical mantle cavity. Such hypotheses suggest that the paired mantle cavity arrangement is inefficient as the anus lies in between the ctenidia. Many suggest that this is deleterious because fouling of the gills can occur; furthermore the flow through a symmetrical mantle cavity is thought to be less efficient and brings with it the problem of sediments clogging the gills. Such a mantle cavity is restricted in how it can elongate to accommodate larger gills. Casual observation indicates that large fissurellids typically have expanded mantle or foot tissue, suggesting the probability of the development of additional respiratory surfaces to overcome this problem. I aim to determine if the foot or mantle are being utilised as secondary respiratory surfaces and if such modifications are occurring, whether different responses to increasing size are occurring in different lineages within the fissurellids.
The taxonomical status of the Iberian taxon Xerocrassa barcinensis sensu Soós (1926) (Gastropoda, Hygromiidae) Martínez-Ortí, Alberto*1 & Gittenberger, Edmund2 1 Museu Valencià d’Història Natural, E-46008 Valencia, Spain. Email: alberto.martinez@uv.es2 National Museum of Natural History Naturalis, NL-2300 RA Leiden, The Netherlands. Email: gittenberger@naturalis.nnm.nlSoós (1926) describes the reproductive system of a species that is conchologically identified as Helix barcinencis Bourguignat 1868, from "Guardiola" (Barcelona). The characteristics of the genitalia led Soós to include this species in the genus Trochoidea, thus establishing the new combination Trochoidea barcinensis (currently Xerocrassa barcinensis). Gittenberger (1993) has verified that the anatomy of the typical material of X. barcinencis belongs to Helicella and not to Xerocrassa, thus proving that Helicella barcinencis is a junior synonym of Helicella madritensis, therefore X. barcinencis sensu Soós would need a redenomination. Puente (1994) reassigns X. barcinensis sensu Soós to X. pallaresica, following Gittenberger (1993). A syntype of H. pallaresica has been studied, proceeding from the Fagot collection, deposited at the Museu de Zoologia of Barcelona, allowing us to include this taxon in the synonymy of H. madritensis. This fact implies that the name of the taxon that should be used for X. barcinensis sensu Soós is the next one on the list indicated by Gittenberger, therefore Helix salvanae. Despite the fact that specimens of the type series of this sample have been found neither in the Fagot collection nor in the Salvañà collection (MZB), a sample has been found in the Chía collection (MZB) made up of two shells with two labels. It is our opinion that the latter proceeds from the same original sample, belonging to a syntype according to Art. 72.4.1.1 of the ICZN, due to the fact that Salvañà and Chía were contemporaries and exchanged many samples from their respective collections. After studying both syntypes, we conclude that there must also be considered a junior synonym of Helicella madritensis. This is why X. barcinencis sensu Soós should now be denominated, according to Gittenberger’s list, Helix chiae. The original material has been found neither in Fagot’s, Salvañà’s nor in Chia’s collections and so it should be provisionally denominated as Xerocrassa chiae (Fagot 1886).
The taxonomical identity of three taxa of the genus Iberus Montfort 1810: Helix alcarazana Rossmässler 1854, Helix guiraoana Rossmässler 1854 and Helix guiraoana var. angustata Rossmässler 1854 (Gastropoda, Helicidae) Martínez-Ortí, Alberto1, Robles, Fernando2, & Elejalde, Arantza*3 1. Museu Valencià d’Història Natural, E-46008 Valencia, Spain. Email: alberto.martinez@uv.es 2. Instituto "Cavanilles" de Biodiversidad y Biología Evolutiva. E-46100 Valencia, Spain. Email: roblesf@uv.es 3. Departamento de Zoología y Dinámica Celular Animal. Facultad de Farmacia. Universidad del País Vasco. E-01006 Vitoria, Spain. Email: ggpgomob@vc.ehu.es Helix guiraoana was described by Rossmässler from "Castellón". Paratypes deposited in the Senckenberg Museum of Frankfurt have been revised. Iberus guiraoanus shows a conchological characteristic not found in the majority of the morphos of Iberus, such as a well defined umbilicus. Furthermore, paratypes of Helix guiraoana var. angustata have been studied from the type locality in Granada, also deposited in the SMF, and it has been proved that its conchological characteristics coincide exactly with I. guiraoanus, which is why, in our opinion, H. guiraoana var. angustata should be considered as a junior synonym of I. guiraoanus. Furthermore, these two taxa share the same geographic area around the provinces of Albacete, Jaen and Granada. In the same manuscript, Rossmässler described Helix alcarazana from "Sierra de Segura en Alcaraz". Paratypes deposited in the SMF have been revised too. This species has a subglobose shell without umbilicus, in contrast to I. guiraoanus, for which reason the assignment of Iberus specimens to one species or another, presents no difficulties. In last years intensive samplings have been carried out in the geographic areas close to the type localities of I. guiraoanus and I. alcarazanus. These facts allow us to be sure that I. guiraoanus doesn’t live in "Castellón" and that I. alcazaranus doesn’t live in "Alcaraz" and that on the contrary I. guiraoanus lives in "Alcaraz" and I. alcazaranus lives in "Castellón". Therefore, in our opinion, somehow there must have been a mix-up with the labels of the original samples of I. guiraoanus and I. alcarazanus, both of which were collected by Guirao, previous to the description carried out by Rossmässler, who probably received the samples labelled incorrectly. In accordance with the recommendation 76.A.2 of the ICZN, we have corrected the declaration of the respective type localities: I. guiraoanus: "Sierra de Segura en Alcaraz" and I. alcarazanus: "Castellón". Acknowledgements: This work has been partly financed by the projects: 1/UPV00076.125-E-13713/2001 and REN2002-00716
Preliminary study of the type specimens of the malacological collections deposited in the Museu de Zoologia of Barcelona (Spain) Martínez-Ortí, Alberto*1, Uribe, Francesc2, & Nebot, Jordi2 1. Museu Valencià d’Història Natural, 46008 Valencia, Spain. Email: alberto.martinez@uv.es 2. Museu de Zoologia de Barcelona, 08003 Barcelona, Spain. Email: furibe@mail.bcn.es The Museu de Zoologia of Barcelona (MZB) has a long malacological tradition that began in the second half of the nineteenth century. It has in its care numerous collections of molluscs, made up of an elevated number of terrestrial, freshwater and marine species. In recent years, important advances have been achieved in the cataloguing procedures, through the implementation of data bases and the disposition and arrangement of the lots that make up these collections. Special interest has been taken in the "type specimens" given their taxonomical importance. In all, the malacological collections consist of approximately one hundred thousand lots and around one hundred "type specimens". As is widely accepted, the study of the type material is increasingly indispensable for gaining more knowledge about the status of numerous taxa of molluscs. In this respect, the MZB would like to offer the scientific community a catalogue of "type specimens" that it possesses, in accordance with the 72F Recommendation of the International Code of Zoological Nomenclature (2000). The "type specimens" in the custody of the museum proceed from the collections of A. Bofill i Poch, J.B. d’Aguilar-Amat, L. Gasull, M. Chía, J. Maluquer i Nicolau, F. Martorell y Peña, J. Rosals, J.M. Salvañà, B. Serradell and A. Torres Mínguez as well as some lots donated to the museum by malacologists whose principal collections are deposited in other museums: C. Altimira, V. Borredà, P. Fagot, F. Haas, S. Gofas, A. Martínez-Ortí, C.E. Prieto and A.I. Puente. The usual pattern used by many other museums, is being applied in the elaboration of the catalogue, detailing the original and actual nominal combinations of the taxa, the synonymies, and mention as to whether they are holotypes, lectotypes, neotypes or syntypes, as well as the data on the location of the remaining specimens of the type series, the known distribution of the species, and data of the type locality including references to any other relevant works on any of them should there be any.
Temporal shifts in the allocation of energy in the arrow squid, Nototodarus gouldi: sex-specific responses McGrath-Steer, Belinda L*. and Jackson, George D. Institute of Antarctic and Southern Ocean Studies, University of Tasmania, Private Bag 77, Hobart 7001. Email: bmcgrath@utas.edu.au Squid typically display considerable intra-specific plasticity in size and age-at-maturity in response to ambient environmental conditions, yet little is known of the mechanisms driving these variations. We examined the intra-specific variability in Nototodarus gouldi reproductive traits to determine patterns of energy allocation between somatic and reproductive processes over short temporal scales. Females caught during the cool months of May and July were larger, had slower life-time growth and lower gonad investment and better somatic condition than females caught during the warmer months, suggesting a trade-off between gonad investment and somatic condition in females. On the other hand, males showed a tight coupling between somatic condition and gonad investment for most months, with increases in somatic and gonad tissue occurring concurrently. In male squid, an increase in lifetime growth rate was coupled with an increase in the relative weights of somatic and reproductive structures, whereas in females, increases in %BW day-1 were correlated only with gonad development. Patterns of repro-somatic investment in mature females had implications for spawning strategies, since female squid with higher levels of gonad investment apparently released batches of eggs together as a group, regardless of body size, whereas females with low gonad investment possibly spawned their eggs independently of one another. In terms of life-history theory, male squid were able to rapidly respond to environmental fluctuations without compromising either the gonad or the soma. However, although mature females did not appear to respond as quickly to ambient conditions, female squid possibly produced two different reproductive strategies, possibly to maximise offspring survival in either a stable or a variable environment. It seems from our study that monthly variations in ambient conditions may have large effects on life-history strategies.
Investigating the life history and aquaculture potential of the marine mollusc Dicathais orbita McKechnie, Joy School of Biological Sciences, Flinders University of South Australia, GPO Box 2100, Adelaide, SA 5001, Australia. Email: joy.mckechnie@flinders.edu.au Dicathais orbita is a large predatory gastropod (Family Muricidae), which is native and common to southern Australian waters. This gastropod is at present harvested along the New South Wales and Victorian coasts by a relatively small recreational fishery and used as food and bait. D. orbita is not only edible, but also contains active ingredients that have been shown to display potential medicinal properties. In light of these health benefits there is strong potential for this species to be utilised on a commercial basis. However, it is questionable if wild stocks could sustain a higher level of commercial demand, hence it is suggested that this demand be fulfilled by culturing these animals in an aquaculture system. To date, there have been no documented attempts to aquaculture D. orbita, and information on their life history, reproduction, development and conditions needed for optimal growth, is scarce. It is therefore, the aim of this research to assess the feasibility of culturing an ecologically and economically sustainable supply of this species through aquaculture. Specifically, this project will investigate the reproductive biology, larval settlement and metamorphosis of D. orbita with the ultimate aim of establishing a self replenishing population in aquaria. Once this population has been established it will be used to define growth rates and to determine an effective means of aging and sexing the animals. Experiments will be established to investigate the effect of abiotic factors such as temperature on gonad ripening with the ultimate aim of determining a method of inducing maturation. In addition, feeding trails will be conducted to investigate the effect of natural and artificial diets on the growth, survival and tissue quality of the animals.
Interactions between the indigenous mussel Perna perna and the invasive Mytilus galloprovincialis on the south coast of Africa McQuaid, C.D., Bownes, S., Zardi, G. & Rius, M. Dept of Zoology and Entomology, Rhodes University, Grahamstown, South Africa Mytilus galloprovincialis appeared on the upwelling dominated west coast of South Africa in the 1970s. There it extends to the bottom of the shore and has displaced the mussel Aulacomya ater. Since 1990, Mytilus has spread 1000km along the south coast, where the dominant indigenous mussel is Perna perna. Mytilus densities are highly site-specific with no east-west trend and sites separated by only 10s km may be dominated by different species. Where Mytilus is abundant, it dominates the high mussel zone and Perna the lower shore with overlap between the two (as in North Africa). A field experiment on competition for space between Perna and Mytilus was terminated after a storm eliminated many experimental plots. Storm induced mortality was zone dependant and higher for Mytilus, especially on the low shore. The same pattern occurs even without storms. Both species show byssus failure mostly at the substratum/plaque when in beds and the thread when solitary, but Perna produces more, thicker byssus threads and has higher tenacity. Tenacity alone cannot explain the absence of Mytilus from the lower shore as it occurs there at very exposed sites on the west coast, unless tenacity is lower in the warmer waters of the south and north coasts of Africa. Perna settlement is less consistent through the year and post-settlement mortality of recent recruits is greater on the high shore than for Mytilus. This could explain the absence of Perna from this zone. Habitat segregation may also be partially explained by interaction between the two species (eg. Mytilus grows faster during winter, which may be a competitive advantage). The consequences to infaunal diversity of replacing Perna with Mytilus are unknown, but differences in mussel bed architecture may affect infaunal biomass.
Opisthobranch genomics: Mitochondria and beyond Medina, Mónica*, Takaoka, Tori, Vallès, Yvonne, Gosliner, Terry and Boore, Jeff 1. DOE Joint Genome Institute, Walnut Creek CA, USA. email: M_Medina@lbl.gov 2. California Academy of Sciences San Francisco CA, USA Opisthobranch gastropods exhibit highly modified body plans relative to prosobranch snails, and rampant morphological homoplasy has been invoked to explain the difficulty to resolve multiple clades. Portions of the mitochondrial genome have been used as a phylogenetic marker to resolve relationships at multiple levels of divergence with different levels of success. In recent years obtaining complete mitochondrial genome sequences has become a feasible alternative for molecular systematics studies where there is still lack of resolution. New evidence from gene order and sequence data for twelve taxa provides insight into the evolution of this group with high levels of support. With the advent of mitochondrial genomics as a powerful phylogenetic alternative, the opisthobranch tree seems now within reach and several evolutionary questions can now be addressed with the use of modern genomic and developmental techniques.
Aspects of galeommatoidean systematics Middelfart, Peter Malacology Section, The Australian Museum, Sydney, NSW 2010, Australia. Email: peterm@austmus.gov.au The cosmopolitan superfamily Galeommatoidea is a highly diverse group of taxonomically confusing bivalves occupying numerous marine habitats. Some species live in association with marine invertebrates such as crustaceans, echinoderms, sipunculans, etc., while others live freely in sediments or attached to harder substrates. They have only been dealt with superficially due to their small size and cryptic characters. The family composition of the Galeommatoidea is unclear, especially when a range of characters and taxa are considered. For this reason only the family Galeommatidae was used in a recent overview of the superfamily although 4-5 families are generally recognized, ie. Galeommatidae, Kelliidae, Lasaeidae, and Montacutidae. Currently more than 110 genera are considered valid in the Recent and fossil faunas and more than 400 Recent species are recognised world-wide. The Australian galeommatoidean genera are currently being revised using morphological as well as molecular characters and it is hope that this revision will extend to include many genera outside Australia.
Toward a phylogeny of Veneroidea Mikkelsen, Paula M. 1*, Bieler, Rüdiger 2, Kappner, Isabella 2, & Rawlings, Timothy A. 3 1. Division of Invertebrate Zoology, American Museum of Natural History, Central Park West at 79th Street, New York, New York 10024-5192 USA, Email mikkel@amnh.org 2. Department of Zoology (Invertebrates), Field Museum of Natural History, 1400 South Lake Shore Drive, Chicago, Illinois 60605 USA 3. Department of Biological Sciences, Florida International University, Miami, Florida 33199 USA The largest marine family of Bivalvia, the Veneridae with about 500 extant species, comprises one of the least understood and most poorly defined groups. This is surprising given that it includes some of the most economically important and abundant bivalves, such as cherrystone, quahog, Manila, and Pismo clams. A review of previous phylogenetic analyses of the superfamily Veneroidea (= Veneridae, Petricolidae, Glauconomidae, Turtoniidae, ?Neoleptonidae) shows minimal taxon sampling leading to weak conclusions at this level. Previous work on the family Veneridae has mainly focused on traditional (taxon-defining) shell characters, which are notoriously variable within each of the 12 currently recognized subfamilies. To date, only 30 species have been included in any phylogenetic analysis, either morphological or molecular. The most robust so far only spans 14 species and six subfamilies, resolving only one subfamily (Tapetinae) as monophyletic. No previous analysis has tested monophyly of the 12 subfamilies and none has involved specimen-verified anatomical characters. A new analysis of Veneroidea is presented, including more than 100 species and all 12 venerid subfamilies, and employing shell, anatomical, and molecular (16S) characters. Preliminary results suggest the need for reinterpretation of various morphological features, and support of only some of the currently used taxa. Supported by NSF-PEET DEB-9978119.
The importance of biological invasion on molluscan ecology and biodiversity: A 21st century perspective Miller, A.W. Marine Invasions Research Laboratory, Smithsonian Environmental Research Center, 647 Contees Wharf Road, Edgewater, MD 21027 USA, Email: wmiller@serc.si.edu Through evolutionary history, molluscs have adapted to a vast range of environmental conditions, successfully radiating into a huge array of habitats. Because of their extensive diversity, molluscs are integrally tied to the ecology of many biological communities. As such, molluscs represent a large and varied target on which global change can act. Among the many global environmental insults visited on natural ecosystems by humans, biological invasions are a mounting problem that affects habitats in marine, freshwater, and terrestrial ecosystems. In a world of rapid species exchange, molluscs embody both the invader and the invaded. Biological invasions may alter dynamics at a variety of trophic levels. Native biota experience predation and competition pressures from non-native molluscs and from other non-native fauna. Native molluscs may also be prone to introduced diseases and parasites. All such interactions have the potential to shape population dynamics and ultimately influence the biodiversity in recipient communities. An overview of our current knowledge of biological invasions and invasion pathways as they relate to molluscan ecology will be presented.
Spatial and seasonal variation in reproductive characteristics and spawning of southern calamary: spreading the mortality risk Moltschaniwskyj, Natalie A. & Steer, Michael A. School of Aquaculture, Tasmanian Aquaculture and Fisheries Institute, University of Tasmania, Locked Bag 1370, Launceston, TAS 7250, Australia Southern calamary in Tasmania form spawning aggregations in Great Oyster Bay on the central east coast of Tasmania during spring/summer, which are targeted by commercial fishers. However, it is not known if similar aggregations occur further south in Tasmania or at other times of the year, especially since this species lives for less than a year. Therefore, the aim of this study was to describe and identify differences in reproductive ecology of southern calamary on the east and south-eastern coast of Tasmania. This was achieved by sampling adults and surveying egg masses during 2001 at inshore sites in both regions. Inshore populations of southern calamary in both regions showed a consistent seasonal trend of large gono-somatic index, reproductive output and body size, and greatest abundance during spring, and lowest in autumn. The number of egg masses found was higher on the east coast, where mature animals formed large spawning aggregations during the spring and summer. Such aggregations however were not observed during winter or autumn. Along the south-east coast spawning activity was sporadic, resulting in isolated, low density, egg patches deposited over broader spatial areas during spring, summer, and winter. There was no evidence of areas of seagrass or macroalgae with large depositions of egg masses at any time in the south-east. It appears by adopting different spawning behaviours in different locations and seasons that southern calamary may spread the mortality risks in both space and time. The biological significance of this is unclear, particularly with respect to understanding the mechanisms that drive the development of spawning aggregations. Both spatial and seasonal spawning patterns appear to be the result of very specific use of inshore sites at certain times of the year. Consequently, any management concerns about fishers targeting spawning aggregations in the south-east may be unfounded.
Molluscs on Pyura stolonifera: responses to changes in the physical arrangement of the ascidians Monteiro, S. Centre for Research on Ecological Impacts of Coastal Cities, Marine Ecology Labs, A11, University of Sydney, NSW 2008, Australia Current address: Laboratorio Maritimo da Guia, Estrada do Guincho, 2750-642 Cascais, Portugal. Email: smmonteiro@mail.fc.ul.pt
Beds of the ascidian Pyura stolonifera are a common site in low shore areas in Australia and provide a habitat for a variety of organisms including molluscs. Some of these live among the Pyura, others in the surrounding rock, others still, much smaller in size, live on the Pyura themselves. At the scale of individual Pyura ascidians can be clumped together or isolated from each other. Assemblages associated with clumped and isolated Pyura were significantly different. Differences were still detected when only molluscs were considered. Several models could account for this pattern, the simplest being that isolated and clumped Pyura are intrinsically different. An alternative would be that being surrounded or not by other Pyura creates a different environment for associated organisms. An experiment involving changing the arrangement of Pyura by moving them around was set up to test predictions from these models. No effects of manipulating Pyura were detected in the case of mollucscan assemblages but some effects were detected for some of the individual taxa analysed. Results for assemblages supported the model that, being surrounded or not by other Pyura creates a different environment for associated organisms but results for individual taxa were not as clear. Implications of these results and the need for further experiments are discussed.
Pulmonate phylogeny – what do we really know? Mordan, Peter B.1* and Wade, Christopher M.2 1. Department of Zoology, The Natural History Museum, London SW7 5BD, UK. Email: p.mordan@nhm.ac.uk 2. Institute of Genetics, University of Nottingham, Queen’s Medical Centre, Nottingham NG7 2UH, UK Pulmonate gastropods represent the most significant invasion of non-marine habitats by the molluscs, and include numerous species of medical and agricultural importance. The subclass Pulmonata was first named by Cuvier almost 200 years ago, and at that time comprised the main land and freshwater groups, as well as two essentially marine families, the Onchidiidae and Ellobiidae. Since then many new families of land, freshwater and marine pulmonates have been described. This review traces the recent history of pulmonate classifications and phylogenies based on morphology, in order to see whether any robust hypotheses of relationships between the major groups have emerged and, if so, what characters these are based on. It also addresses the impact of molecular studies, and whether any consensus between these two approaches can be reached. The stylommatophoran land snails and slugs, comprising perhaps 30,000 species, are by far the most diverse group of pulmonates. A large molecular phylogeny of the Stylommatophora, based on partial rRNA sequence data, is discussed, and compared with other investigations, both morphological and molecular.
Inter-annual and spatial variation in spawning periodicity in blacklip abalone: A case study from South-East Tasmania. Mundy, Craig N.* 1, Gurney1, Leigh J, & Nash, Warwick2 1. Tasmanian Aquaculture & Fisheries Institute, University of Tasmania, Private Bag 49, Hobart, Tasmania, 7001. Email: Craig.Mundy@utas.edu.au 2. The WorldFish Center, c/- Secretariat of the Pacific Community, B.P. D5 - 98848 Noumea Cedex - New Caledonia Spawning periodicity in blacklip abalone Haliotis rubra was investigated at three sites in South East Tasmania. Gonad Indices and qualitative staging of gonad sections for 10 females were obtained monthly at George III Rock Reef between January 1988 and January 1992, and monthly from Port Arthur and Shag Rock Bay between January 1991 and February 1992. Oocyte stage frequency and Oocyte size frequency data were obtained from George III Rock samples for 12 months in 1991. These data are used to examine temporal and spatial patterns in spawning activity, and variation within and among individuals. Inter-annual spawning patterns were complex and unpredictable with asynchrony among and within individuals in a given month. Evidence of significant spawning events were rare and were not strongly seasonal, although spawning activity was largely absent in December and January of all years at George III Rock. During 1991, monthly patterns of GI and gonad stage at Shag Rock Bay, Port Arthur and George III Rock contrasted strongly. Evidence of spawning was apparent in histological samples of at least some individuals in every month sampled, and pre-vitellogenic oocytes were always abundant with minor seasonal variation. The implications of multiple asynchronous spawning events for blacklip abalone ecology and fisheries management are discussed.
Evolution and diversity of land snails in a laboratory of nature: the Aegean archipelago Mylonas, M.*, Giokas, S., Parmakleis, A., Triantis, K.A. & Vardinoyannis, K. Natural History Museum of Crete, P.O. Box 2208, University of Crete, Irakleio, 71409 Irakleio, Crete, Greece. Email: mollusca@nhmc.uoc.gr After 200 years of scientific research land snails are one of the best-studied animal groups in the Aegean archipelago. Although there are more than 400 species distributed in the Aegean islands, and nearly 50% of them are endemic, the diversity of several genera is still fuzzy. We estimate that the number of species could range between 350 and 600. The Aegean archipelago is not just a geomorphological, climatic and ecological puzzle, but it is mainly characterised by the speed that its features change. Isolation that is the main causal factor of biodiversity on island ecosystems, in the Aegean archipelago is not a simple phenomenon. It changes not only due to tectonics and eustatism but also due to the long human presence in the area, since man alters dispersal and survival ability of different species. Based on contemporary phylogenetic studies, population and evolutionary ecology we focused our study on certain genera, Mastus, Albinaria, Helix, Zonites that are highly differentiated in the Aegean. We also approached the diversity of the whole malacofauna looking for causal phenomena that influence island diversity, beyond the classic species-area relationship. These analyses combined with the understanding of the peculiarities of the Aegean enable us to approach processes of a broader evolutionary and biogeographic interest.
Sri Lankan snail diversity: faunal origins and future prospects Naggs, Fred *1 Raheem, Dinarzarde2 1. Department of Zoology, The Natural History Museum, London SW7 5BD, UK. Email: F.Naggs@nhm.ac.uk 2. Department of Zoology, The Natural History Museum, London SW7 5BD, UK. & Department of Zoology, University of Cambridge, Downing Street, Cambridge CB2 3EJ, UK. The strong representation of taxa of Gondwanan origin and the distinctive composition of the Sri Lankan snail fauna relative to that of India has long been a source of puzzlement. Sri Lanka is a small area of the Deccan Plate separated by the shallow and narrow Palk Strait from the Indian mainland. It nevertheless appears to have been subjected to long periods of isolation both as an island surrounded by sea and in terms of the discontinuity between the island’s wet forest zone and comparable areas on the Indian mainland. Investigations to establish Sri Lankan land snail faunal associations are in their infancy but three major events can be recognised as having contributed to the structure of the fauna. The break up of Gondwana, formation of the Deccan traps at the K/T boundary and the Early Cenozoic land connection established with Laurasia, shaped the region’s faunal identity. The current impact of alien exotic species is set to shape its future.
Systematic reconsideration of Patelloida pygmaea (Dunker, 1860) (Gastropoda: Lottiidae)
Nakano, Tomoyuki * & Ozawa, Tomowo Department of Earth and Planetary Sciences, Nagoya University, Nagoya 464-8602 Japan. Email: tomo@geobio.eps.nagoya-u.ac.jp
Patelloida pygmaea (Dunker) and its closely allied species, Patelloida heroldi (Dunker) and Patelloida conulus (Dunker) have incorporated nomenclatural confusion for their variable shell morphology and habitats. P. pygmaea live on the shell of Crassostrea gigas (Ostreidae), P. pygmaea form heroldi occur on rocks in sheltered intertidal rocky shores and P. pygmaea form conulus are found on the shell of Batillaria (Batillariidae). In the current nomenclature of limpets, three species of Patelloida by Dunker have been synonymized and treated as P. pygmaea (Dunker) and their ecological forms, P. pygmaea form heroldi (Dunker) and P. pygmaea form conulus (Dunker). Their taxonomic relationships have, however, still been unclear, as there is no definite reason why they are ecological forms of a species. Using two mitochondrial genes (fragments of COI and 16S ribosomal RNA; total 961 sites), we analyzed a total 81 specimens of P. pygmaea, P. pygmaea form heroldi and P. pygmaea form conulus from 32 localities within Japan. In the resultant molecular phylogenetic trees, the specimens of Patelloida fall into four clades with high bootstrap probabilities; each clade taxonomically corresponds to P. pygmaea, P. conulus, P. heroldi and a fourth previously unrecognized taxon, Patelloida ryukyuensis n. sp. Minimum Spanning Network for 29 unique mitochondrial COI haplotypes obtained from 45 specimens in the same bay in central Japan form three distinct clusters consisting of P. pygmaea, P. conulus and P. heroldi, respectively. This evidence reveals that reproductive isolation has been established within each group. A detailed examination of radular and shell morphologies of the four taxa discriminated by molecular phylogenetic analyses also clarified the morphological distinction between the species. The four species form a rather young clade in the genus Patelloida that diverged during the Plio-Pleistocene. They provide the molluscan ecology a nice example of mutual habitat segregation in a restricted marine environment.
Phylogeny of southern African Tricolia (Gastropoda: Turbinidae) based on mtDNA sequences Nangammbi, T.C.*1, Herbert, D.G.1 & Mitchell, A.2 1. Natal Museum, P. Bag 9070, Pietermaritzburg 3200, South Africa, and School of Botany and Zoology, University of KwaZulu-Natal, P. Bag X01, Scottsville, Pietermaritzburg 3209, South Africa. Emails: tnangammbi@nmsa.org.za; dherbert@nmsa.org.za 2. School of Molecular and Cellular Biosciences, University of KwaZulu-Natal, P. Bag X01, Scottsville, Pietermaritzburg 3209, South Africa. Email: mitchella@ukzn.ac.za
The species-level taxonomy and biogeographic affinities of the southern African Tricolia Risso (1826) fauna are poorly known. Twenty-two nominal taxa referable to the genus have been described in southern Africa, the majority by Turton (1932). However, Turton was a notorious splitter and no detailed systematic revision has ever been undertaken on the southern African members of this genus. Morphological evidence suggests that only 11 taxa represent valid species, while 11 are synonyms. In this paper, sequence data from the mitochondrial COI gene (658bp) are used to assess the relationships between taxa, test monophyly and investigate the biogeographical affinities of the southern African Tricolia radiation. The fauna includes southern African endemics, Eastern Atlantic and Indo-West Pacific taxa. Maximum parsimony analyses revealed that the genus Tricolia is paraphyletic. However, the endemic southern African Tricolia species form a monophyletic group, within a broader European and Indo-West Pacific clade. As yet, however, there is no indication from the molecular data as to whether this endemic southern African clade is of Atlantic/European or Indo-West Pacific origin. There is also strong evidence, which suggests that one taxon ‘Tricolia’ neritina is distinct from other southern African Tricolia species in terms of both COI sequences and conchological characters. This taxon has already been described under another supra-specific name Chromotis Adams and Adams (1863) and the COI sequences suggest that it is a genuinely distinct entity. Tricolia insignis, T. kraussi and T. bicarinata are conchologically similar, with intergrading shell characters. The COI data indicate that they form a monophyletic group (80-99% bootstrap support) and are closely related (less than 2% sequence divergence within the group), and might even be one species exhibiting environmental/geographical variation in shell form.
Architecture of the ‘physid musculature’ Naranjo-García, Edna1* & Appleton, Christopher C.2 1. Departamento de Zoología, Instituto de Biología, Universidad Nacional Autónoma de México, Apartado Postal 70-153, México, D.F. 04510 Mexico. Email: naranjo@servidor.unam.mx 2. School of Life and Environmental Sciences, Howard College Campus, University of KwaZulu-Natal, Durban 4041, South Africa In 1964 Harry & Hubendick identified the "physid musculature", a set of muscles present only in the pulmonate Family Physidae. This musculature lies in close association with the columellar muscle and is anatomically complex. Physa acuta from Mexico and Brazil were used to examine this musculature; notes and a series of camera lucida drawings were made as dissection proceeded. We have divided the physid musculature into several parts. (1) A lower part located on right hand side of body and giving rise to four bands running to the neck and head, entwining with columellar muscle fibers descending the neck. A 5th band descends and surrounds the columellar muscle from the back. The upper part is composed of a) the fan muscle which attaches to the ceiling of mantle and b) a band of fibers that crosses the lung floor towards the pneumostome. Fibers from the columellar muscle also reach this corner of the pneumostome. (2) A band of fibers running in a straight line from the mantle collar (pneumostome level) across the middle of mantle to entwine with fibers of the fan muscle. The columellar muscle also comprises upper and lower sections. The upper section has four main elements three of which descend toward the neck, head and flanks. The 4th is attached longitudinally to the 3rd columellar muscle element and is itself made of two parts: a lower half formed by a wide band of fibers and an upper half which fans out to constitute part of the left side of lung wall. We propose that the physid musculature plays a role in the physids’ unique ability to flick their shells rapidly from side to side – a movement that frequently enables them to escape predation. We have identified three possible points of articulation for this ‘physid movement’.
Packaging reproductive effort in the whelk, Buccinum undatum: how females of different sizes trade off numbers and size of offspring Nasution, S.1, Roberts, D. 2 & Elwood, R.W.E. 2 1 Fisheries Faculty, University of Riau Pekanbaru, Sumatera, Republic of Indonesia.2 School of Biology and Biochemistry, Queen’s University, Belfast BT9 7BL UK. Email: d.roberts@Queens-Belfast.ac.ukBuccinum undatum deposits capsules in large numbers attached irregularly to each other. Each capsule has a large number of eggs, however, only a few young emerge from such capsules the remaining eggs being used as food. In common with most animals, reproductive output increases with the size of the female. Large B. undatum produce a greater number of larger capsules containing more eggs than do small females. In addition, large B. undatum produce large young. The larger young may result from larger eggs or the female may provide more nurse eggs for each developing egg. This begs the question of why large females do not simply keep the capsules the same size as those produced by smaller females, each with the same number of developing eggs and nurse eggs and all of the same size as produced by small females. More eggs could then be produced resulting in the production of more juveniles. However, as these are slow moving animals that remain in the vicinity of the egg masses after hatching, sib-sib competition is likely to occur at that time also, leading to the same prediction of larger offspring rather than more offspring, or at least a trade-off between offspring size and number. B. undatum, thus provides an excellent model to examine how and why large females produce larger young rather than more young, as it subdivides each clutch of eggs into numerous small capsules and, within each, there is a potential trade-off between number of eggs, size of eggs and provision of nurse eggs. This study describes how females of different sizes allocate resources in terms of capsule number, capsule size, number of eggs per capsule, egg size and number of nurse eggs per emerging juvenile and assesses how resource allocation influences the numbers and size of emerging juveniles and overall reproductive success.
Richness and evenness of Eastern North American land snail communities Nekola, Jeffrey C. Department of Natural and Applied Sciences, University of Wisconsin - Green Bay, Green Bay, Wisconsin 54311, USA. Email: nekolaj@uwgb.edu Biodiversity of the eastern North American land snail fauna was studied using a dataset of over 430,000 individuals and 166 species from 838 sites. Community richness and evenness was documented from 10 cm to 2800 km extents across five major habitat types (bedrock outcrops, upland forest, lowland forest, upland grassland, lowland grassland). Appropriate 0.01 m² microsites supported up to 23 taxa, or roughly a quarter of a regional fauna. 10% of sites (<1000 m²) harbored 24 or more taxa, with a maximum of 39. Rock outcrop habitats supported significantly (p<0.0005) more species per site, and a higher proportion of the regional fauna (>60%), as compared to other habitats. Median site richness decreased (p<0.0005) 3-fold with increasing latitude, although acidic habitats in coastal Carolina also had limited richness (<10 taxa/site). However, as the proportion of a regional fauna harbored within single sites increased (p<0.0005) with latitude from the Carolina coast (8.3%) to Churchill, Manitoba 41%), the role of between-site environmental gradients in maintaining regional diversity was greater towards the south. Shannon Index heterogeneity values generally ranged from 70-80%. Dominance-diversity curves became more shallow and had larger shoulders of equally common species with decreasing latitude and environmental stress levels. Such sites had abundance patterns characteristic of random niche partitioning (e.g. the 'broken-stick' hypothesis). Species abundances in meta-communities across the region deviated only slightly from log-normal expectations, with only minor enrichments in rare taxa being noted. Neutral community models suggest that such patterns are likely to develop when there is severe habitat isolation and dispersal limitation. These analyses show for all but the most environmentally stressed regions/habitats, Eastern North American land snail communities are characterized from small to large scales by high richness and evenness, making their typical community structure reminiscent of the most diverse terrestrial biotic assemblages (e.g. tropical forest trees).
Microanatomy and ultrastructure of Unela sp., an interstitial acochlidian gastropod from Bermuda Neusser, Timea, Haszprunar, Gerhard, Heß Martin, & Schrödl, Michael* Zoologische Staatssammlung München, Münchhausenstr. 21, 81247 München, Germany. Email: timea-neusser@gmx.de; haszi@zsm.mwn.de; hess@zi.biologie.uni-muenchen.de; schroedl@zi.biologie.uni-muenchen.de The Acochlidia are an enigmatic and poorly known opisthobranch group that is subdivided into the Hedylopsacea and Microhedylacea according to current classification. Previous studies by Fahrner & Haszprunar and Sommerfeldt & Schrödl already investigated the marine interstitial, hermaphroditic Hedylopsis sp. (Hedylopsidae) from the Red Sea as a supposedly basal member of the Hedylopsacea. The present study uses Unela sp. (Microhedylidae) as a model organism of the Microhedylacea. More than 20 specimens with up to 2 mm body length were extracted from coarse subtidal sand near Castle Roads, Bermuda Islands. Their central nervous, digestive, excretory and genital systems were reconstructed 3-dimensionally from serial semithin histological sections using AMIRA software. The radula was analyzed by SEM. Ultrathin sections were made for analysis of the sperm structure by TEM. Unela sp. resembles Unela remanei Marcus, 1953 from Brazil and the Caribbean regarding its flattened oral tentacles, cylindrical rhinophores, lack of eyes, and radular characters. In contrast to members of Hedylopsacea and Asperspinidae, Unela sp. shows a nervous system with numerous accessory ganglia and has separate sexes. The oocytes of Unela sp. are large in relation to body size. Sperm is spindle-shaped, showing a keeled head and a mitochondrial derivative with one glycogen helix. The current classification of the Acochlidia is discussed to not reflect natural relationships, but further detailed structural analyses on poorly-known species are required as a prerequisite for reasonable cladistic analysis of the Acochlidia.
Propagation of endangered freshwater mussel populations in the eastern United States Neves, Richard J. Virginia Cooperative Fish and Wildlife Research Unit, U.S. Geological Survey, 106 Cheatham Hall. Virginia Tech, Blacksburg, VA 24061 USA. Email: mussel@vt.edu Of the nearly 300 species of native freshwater mussels in the United States, 35 are presumed extinct and 70 are federally listed as endangered or threatened. Because large mussels are capable of filtering roughly 40 L of water per day, historic mussel beds provided an ecologically important biofiltration function for most rivers in the central and eastern United States. Their filtration of phytoplankton, bacteria, and particulate organic matter from the water column provided an ecological service; namely, to enhance nutrient cycling and improve water quality for other species. The Freshwater Mollusk Conservation Center at Virginia Tech is now propagating and releasing endangered juvenile mussels of species in need of recovery. Initial releases of cultured juveniles began in 1997 and, since that time, roughly 100,000 endangered juveniles per year have been released into various river systems. The techniques and recirculating aquaculture technology now in use with rare species can be applied to any species in any river system of the country. Involvement in mussel propagation by state and federal facilities is now expanding to address the conservation needs of rare species and to produce juvenile mussels for toxicity testing, in order to assess whether water quality criteria are protective of these species. The restoration or augmentation of mussel populations in rivers provides another opportunity to improve water quality and sustain the health of freshwater ecosystems affected by anthropogenic stressors. Propagation of native freshwater mussels now provides a means to recolonize historic habitats and restore the natural biofiltration system of waterways throughout the United States.
A comparison of survey methodologies for assessing populations of Dicathais orbita in South Australia Noble, W. School of Biological Sciences, Flinders University, GPO Box 2100 Adelaide SA 5001, Australia. Email: nobl0038@flinders.edu.au Dicathais orbita is an ecologically important predatory whelk on Southern Australian intertidal reefs. Populations of this species are being impacted on by human harvest and pollution-related imposex. The structural complexity of rocky intertidal shores combined with the cryptic nature of many important molluscan species in these habitats requires optimization of survey methods for monitoring purposes. Three different survey methods; belt transects, timed searches and adaptive cluster surveys were used to gather abundance data for D. orbita on South Australian shores. Belt transects and timed searches are simple methods that have been applied frequently to survey organisms in marine and terrestrial habitats. Adaptive cluster surveys have not been previously employed in rocky intertidal shores, but have been shown to be efficient for sampling rare or clustered organisms. These three methods were compared to each other in terms of efficiency (no. of individuals counted/min) and precision (as a function of the variance of the sample estimate i.e. P = SE/X) . For both of these measures, timed searches performed significantly better than either belt transects or adaptive cluster surveys. Thus timed searches are recommended for future monitoring of D. orbita population abundances. This study presents new information on appropriate survey methods for D. orbita at previously unstudied locations in South Australia. Implications for comparisons of results from separate studies are also discussed with respect to survey methods.
Comparative radula morphology of Paludomus spp. in the Kwae Noi River watershed, Kanchanaburi, Thailand Notesiri, N., Krailas, D.*, Janecharat, T., Tharapoom, K., Kitikoon, V. & Ukong, S. Department of Biology, Faculty of Science, Silpakorn University, Nakhonpathom, 73000 Thailand. Email: kduang@su.ac.th
A comparative study of the radula morphology of freshwater snails genus Paludomus of Kwae Noi River watershed, Kanchanaburi Province is carried out to see if this kind of study can be used to determine the taxonomic relationship of Paludomus spp. The freshwater snails were collected from ten different locations of the water source, Although all of collected snails exhibit Taenioglossa form, which has dentition formula 2:1:1:1:2 (marginal:lateral:rhachis:lateral:marginal), interesting differences are noted among the cusp formula of the teeth. Statistic analysis is performed using ANOVA tests. Comparative study of number, shape and size of cusps illustrates that the snails from Tao Dum stream, one of the ten survey locations, are noticeably different from the others. The central tooth width of the freshwater snails from Tao Dum stream are significantly different (P<0.05) from the others. The result of the study supports the hypothesis that the snail from Tao Dum is a unique species. This work was supported by the Research and Development Institue, Silpakorn University, Thailand and the TRF/BIOTEC Special Program for Biodiversity Research and Training grant BRT T_145038.
Comparative shell morphology of Paludomus spp. in the Kwae Noi River Watershed, Kanchanaburi, Thailand
Notesiri, N., Krailas, D.*, Janecharat, T., Tharapoom, K., Kitikoon, V. & Ukong, S. Department of Biology, Faculty of Science, Silpakorn University, Nakhonpathom,73000 Thailand. Email: kduang@su.ac.th A comparative study of shell morphology of Paludomus spp. collected from ten locations in the Kwae Noi River watershed, Kanchanaburi, Thailand, is carried out. These Paludomus freshwater snails are distinguished by shape, size, shell color pattern, suture, body whorl sculpture, operculum and the other basal periphery. All of them are dextral and the operculum is concentric with spiral. The shells are elongated and subglobose in shape. The surface is smooth and covered with a brownish or greenish periderm. Most of them show pointed apex, deep suture, and narrow columella. However, the snails of Tao Dum stream, one of the ten survey locations, are markedly different from the others in that they show eroded apex, shallow suture, and wide columella. In addition, when the ratios of the length of body whorl/shell length and size index are analyzed using ANOVA tests, Tao Dum snails exhibits significant difference (P<0.05) in the size index. Duncan multiple range test and Scheffe test further support the finding. This work was supported by the Research and Development Institue, Silpakorn University, Thailand and the TRF/BIOTEC Special Program for Biodiversity Research and Training grant BRT T_145038.
Seasonal changes of thermal preferences in the Helix pomatia and their relation to winter torpor Nowakowska, A. Caputa, M., Rogalska, J. & Wentowska, K. Department of Animal Physiology, Institute of General and Molecular Biology, N. Copernicus University, Toru ń, Poland. Email: noann@biol.uni.torun.plMammalian hibernators, are able to start behavioural, endocrine and physiological preparing for hibernation long before winter begins. Does overwintering in the Helix pomatia snails depend also on the endogenous mechanisms? Or is it evoked passively by a drop in ambient temperature? Because mammals actively select reduced ambient temperatures before entering hibernation recording long-term changes in thermal behaviour of the snails should allow to answer these questions. Another aim of the investigation was to elucidate the role of food restriction in long-term thermal behaviour of the snail. Experiments were carried out on adult snails collected in the field. In four seasons of the year they were placed in a thermal gradient system, and their thermal preference was automatically recorded. In autumn the recording was performed on both nonstarved and starved snails. In mid-winter torpid snails were exposed to different thermal conditions, and latency of their arousal from torpor, and their immediate thermal preferences were recorded. Torpid snails, collected at the end of February, were kept permanently at 5°C in constant darkness to check their ability to arouse from torpor. There were no seasonal differences in selected ambient temperature. Neither starved nor nonstarved snails were able to select reduced ambient temperatures during long-term autumnal recording. Latency of arousal from winter torpor was inversely proportional to ambient temperature over a threshold of 10°C but in the spring the snails exposed to 5°C were able to arouse spontaneously within a period typical of the snails observed outdoors In conclusion, entering the Helix pomatia snail into winter torpor and its maintenance is a passive phenomenon. Arousal from the torpor, however, is an endogenously controlled response. Supported by grant of 3PO4C 028 24 from the Polish State Committee for Scientific Research
The Caenogastropoda in the Late Palaeozoic and Early Mesozoic: Formation of a superclade Nützel, A. Institut für Paläontologie, Loewenichstr. 28, D-91054 Erlangen, Germany. Email: nuetzel@pal.uni-erlangen.de Morphological (mostly anatomical) characters form a robust argument for the monophyly of the crown-group caenogastropods. However, the identification of Palaeozoic members of fossil stem-group caenogastropods by shell characters is problematic. The evolutionary history of the Caenogastropoda goes back to the pre-Carboniferous but Devonian and earlier data on unequivocal members of the Caenogastropoda are sparse. Morphological overlap and convergence obscure the differences to other major fossil gastropod clades. One of the most informative shell characters is the presence of an orthostrophic, commonly planktotrophic larval shell. New data suggest that such larval shells are also present in the Naticopsidae, a diverse Palaeozoic group which is assigned to the Neritaemorpha. This and the lack of nacre obstruct a clear differentiation between fossil neritaemorphs and caenogastropods, but on the other hand it suggests a possible close phylogenetic relationship. Openly coiled protoconchs are present in several Palaeozoic gastropod clades, amongst them some possible stem-group caenogastropods. This feature was increasingly abandoned during the Palaeozoic and is absent in the Mesozoic. Openly coiled protoconchs are present in some Carboniferous caenogastropods but the status of this character (plesio- vs. apomorphic) is not yet clear. The protoconch is particularly informative within the Caenogastropoda because many have larval shells with numerous characters. E.g., the slit-bearing Goniasmatidae as well as the Orthonematidae have tightly coiled protoconchs which closely resemble those of some Recent Cerithioidea. The presence of a slit or sinus in many Palaeozoic caenogastropods sheds light on the evolution of the mantle cavity in the Gastropoda. A previously suggested relationship to the pleurotomarioideans seems possible but protoconch and shell structure data do not support this view. Ongoing phylogenetic analyses of the Late Palaeozoic and Early Mesozoic caenogastropods show a relatively poor resolution (basal multifurcations) but several distinct clades can be recognized and possible links with Recent gastropods are likely.
Phylogenetic relationships of Polyplacophora: Eggs, sperms and gills Okusu*1, Akiko, Schwabe, Enrico & Giribet, Gonzalo1 Department of Organismic & Evolutionary Biology, Museum of Comparative Zoology, Harvard University, 16 Divinity Avenue, Cambridge, MA 02138, USA aokusu@oeb.harvard.edu Phylogenetic analyses of Polyplacophora based on 5 molecular loci for representatives of 49 species belonging to 40 genera from 15 subfamilies reveal that traditional taxonomy does not reflect evolution. The taxonomic classification of polyplacophorans at a higher level has remained unsettled and phylogenetic studies of Polyplacophora based on morphology are scarce. Early work on chiton systematics has been based mostly on morphology of valves, spicules, and girdle processes, while more recent efforts to test chiton classification and phylogeny have utilized egg hull morphology, gill placement, and sperm ultrastructure in addition to shell valve morphology. We sequenced up to 5 Kb of sequence data including nuclear coding (histone H3) and ribosomal (18S rRNA and 28S rRNA) genes, as well as mitochondrial coding (cytochrome c oxidase subunit I) and ribosomal (16S rRNA) genes. A series of analyses were performed on independent and combined data sets using direct optimization (POY) with parsimony and maximum-likelihood as optimality criteria in a sensitivity analysis framework. We have included sequence data for all classes of molluscs including Aplacophora (with the exception of the unavailable monoplacophorans) as outgroups. Our results conflict with the more traditionally employed characters and refute monophyly of classical taxonomical groups sensu Kaas & Van Belle, such as Ischnochitonina and Acanthochitonina. The topologies are mostly congruent with the results based on egg hull, sperm, and gill morphology.
Oliver, P. Graham Dept of Biodiversity & Systematic Biology, National Museum of Wales, Cardiff, Wales, UK: graham.oliver@nmgw.ac.uk The alternative higher classifications within the Arcoidea are compared and their basis whether morphological (from fossil or living species) or molecular are reviewed. It is evident that recent molecular data challenges accepted morphologically based systems including the monophyly of the Arcoidea. This paper reviews the morphological basis of current generic and family groups. This suggests that over emphasis on characters related to adaptive radiation has led to an over simplified view, especially in relation to the epibyssate/endobyssate dichotomy. This dichotomy is shown to appear repeatedly within many taxonomic levels and is likely to have contributed to monophyletic vision of the Arcoidea and the current divisions within it. Specifically this paper uses the genus Bathyarca to illustrate this radiation and the ark shell morphology to illustrate convergence. Species level taxonomy is briefly reviewed and the difficulties within the Barbatia and Anadara groups are highlighted.
Malacological fauna of the southern Chilean fjords and its biogeographical affinities Osorio R, C.1 & Peña M., R.2 1. Dpto. Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile, P.O.Box 653, Santiago, Chile. Email: cosorio@uchile.cl 2. Facultad de Ecología y Recursos Naturales, Universidad Andrés Bello, Chile The seaboard of continental Chile has an extension of 55.000 km, 95% of which corresponds to the area of the fjords. Because of its topographical characteristics, distance and hard climate, this area has not been studied much, but due to its ecological and economic importance it has become necessary to study its biodiversity. The scientific cruises were carried out in July 2001 in the inner channels and in July 2002 in the outer channels, next to the Pacific Ocean. The samples were taken from the intertidal by means of autonomous diving, down to a depth of 345 m by an Agassiz trawl net on board the B/O Vidal Gormaz. A total of 1490 specimens of mollusks were obtained, distributed into 74 species. The analysis of the diversity of the mollusks shows a decreasing order in the specific wealth, Gastropoda (49.3%), Bivalvia (37.0%), Polyplacophora (6.9%), Cephalopoda (4.2%), Scaphopoda (2.7%) and Caudofoveata (1.3%). Nineteen species are new registrations for the area. The representatives of Veneridae (V. antiqua and T. gayi), Pectinidae (Z. patagonica) and Cymatiidae (A. magellanicus) are economic resources. The greater specific wealth of mollusks was found between 60 – 345 m of depth. The greater abundance (60.1%), between 160 – 200 m of depth. The malacological fauna present in the channels studied shows a confluence of species characteristic of the Atlantic, Magellan province, the Antartic and the Peruvian province. At present, it is estimated that this is an area of wildlife transition, with the regular contribution of species from the adjacent areas and, consequently, endemism of the malacofauna is not observed.
Molecular phylogeny and historical biogeography of Haliotidae (Gastropoda: Vetigastropoda) based on mitochondrial DNA sequences
Ozawa, Tomowo * & Mouri, Yuki Department of Earth and Planetary Sciences, Nagoya University, Nagoya 464-8602 Japan. Email: ozawa@eps.nagoya-u.ac.jp
Members of the Haliotidae (abalones) are globally distributed in tropical and temperate waters. However, taxonomy, systematics, phylogeny and historical biogeography of the family remain unsolved. Using new sequences of mitochondrial COI gene (1456 bp) from 217 individuals, we constructed a molecular phylogeny for 33 species of the genus Haliotis, covering a major part of the family. In the resultant phylogenetic trees, species fall into nine major clades with high bootstrap support. These clades nearly accord with their geographical distribution and the subgeneric division of genus Haliotis in current taxonomy as follows: A) the western coast of North America and Japan (Nordotis); B) New Zealand (Paua); C) Australia (Notohaliotis); D) South Africa (Euhaliotis); E) the western Pacific (Sulculus); F) the tropical western Pacific, (Haliotis); G) the tropical western Pacific (Sunhaliotis); H) the tropical western Pacific (Ovinotis); and I) the Mediterranean to northwestern Africa (Eurotis). Approximate divergence times were estimated using reliable fossil records to determine a reference date. Estimated divergence dates suggest that the nine principal clades were formed during the early Paleocene in association with the disruption of Pangea, which gave rise to new oceans and seaways. Modern geographical distribution of Haliotis was established in association with a sequence of processes following the closing of the Tethys Sea and the establishment of modern ocean circulation systems in the late Cenozoic.
Ancient molluscs – 150-years of studying 500-Ma-old snails Parkhaev, Pavel Yu. Paleontological Institute of the Russian Academy of Science, Profsoyuznaya, 123, Moscow, 117647, Russia. Email: pparkh@paleo.ru In the geological history, the earliest molluscs appeared more than 500 Ma ago at the beginning of the Cambrian, when snails obtained mineralized shells as a part of the mass skeletonization event in different organisms. Since the first descriptions of Cambrian molluscs by James Hall and Alcide d’Orbigny in mid-19th century, the number of taxa has significantly increased by the end of it, as more publications appeared dealing with Cambrian fauna. The newly described species and genera of univalved molluscs were assigned to the already existing families and orders of gastropods, i.e. cap-like forms were grouped together with patelloids, whereas those spirally coiled - with trochids or other primitive groups. Such an approach to the systematics of the Cambrian molluscs dominated until two significant impacts had changed the situation greatly in the middle of 20th century. Impact 1 (1940-1960): introducing Monoplacophora as a fossil order, subsequent discovery of the recent forms and bringing their rank to the class level. Impact 2 (mid-1960s): applying a novel preparation technique, i.e. chemical extraction of microscopic fossils from Cambrian rocks, resulted in appearance of diverse and finely preserved molluscs. Following the pioneer work on the Siberian Cambrian by Alexei Rozanov & Vladimir Missarzhevsky, perfect molluscan assemblages were discovered in the Cambrain of Australia by Bruce Runnegar, John Pojeta (jr.) & Peter Jell, who made their first morpho-functional interpretations. Since then, the state of the systematics of the Cambrian univalved molluscs has been suffering from a perpetual flux. Currently, three main alternative opinions on their nature are being considered: (1) they share gastropod affinities; (2) they share monoplacophoran affinities; (3) most of them represent a separate class. According to the most extreme view, they might not molluscs at all. Such a knotty problem can be cleared only by the combined efforts of paleontologists and neontologists.
Doubly uniparental inheritance in Bivalvia: a noteworthy variation to matrilinear inheritance of the mitochondrial genome Passamonti*, Marco & Scali, Valerio Dipartimento di Biologia Evoluzionistica Sperimentale, University of Bologna. 40126 Bologna, Italy. Email: mpassa@alma.unibo.it Doubly Uniparental Inheritance (DUI) represents an outstanding exception to matrilinear inheritance of Mitochondria, typical of most Metazoa. Some bivalve mollusks posses two different mitochondrial DNA genomes (the so-called M and F mtDNAs) and realize a double mechanism of transmission in which M and F mtDNAs are inherited by father to sons and by mother to daughters, respectively. DUI provides an intriguing system for addressing aspects of molecular evolution and intermolecular recombination of Mitochondrial DNA, in both DUI and non-DUI species. Therefore, studies on DUI bivalve species may have a pivotal role in understanding the evolution of the metazoan mitochondrial genome. DUI was found in a few mussel species (Mytilidae), as well as in several unionids (Unionidae). In our lab, we started a large analysis aimed to detect gender-associated mtDNAs in additional bivalves. A venerid (Tapes philippinarum) and a mytilid species (Musculista senhousia) showed a mitochondrial heteroplasmy pattern, which is in line with a DUI model of mtDNA inheritance. Analyses on T. philippinarum DUI system were useful to test for selection on mtDNA genes under DUI, as well as for mitochondrial DNA recombination. Furthermore, the finding of mtDNA heteroplasmy in a venerid showed that DUI also occurs in phylogenetically distant families and suggested that it might be widely distributed among bivalves. The DUI system of M. senhousia revealed some unexpected traits, different from any previously known ones. Because of its peculiarity, this system challenged most of the rationales proposed to account for mitochondrial genome evolution under DUI.
Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences Passamaneck, Yale J.1,4*, Schander, Christoffer2 & Halanych, Kenneth M.1,3 1. Department of Biology, Woods Hole Oceanographic Institution, Woods Hole, MA, USA 2. Department of Biology (IFM), University of Bergen, Postbox 7800, NO-5020 Bergen, Norway 3. Department of Biological Sciences, Auburn University, Auburn, AL, USA 4. Current address: Department of Cell and Developmental Biology, Weill Medical College of Cornell University, New York, NY, USA The Mollusca represent one of the most morphologically diverse animal phyla, prompting a variety of hypotheses on relationships between the major lineages within the phylum based upon morphological, developmental, and paleontological data. Analyses of small-ribosomal RNA (SSU rRNA) gene sequence have provided limited resolution of higher-level relationships within the Mollusca. Recent analyses suggest large-subunit (LSU) rRNA gene sequences are useful in resolving deep-level metazoan relationships, particularly when combined with SSU sequence. To this end, LSU (~ 3.5kb in length) and SSU (~ 2kb) sequences were collected for 33 taxa representing the major lineages within the Mollusca to improve resolution of intraphyletic relationships. Although the LSU and combined LSU + SSU datasets appear to hold potential for resolving branching order within the recognized molluscan classes, low bootstrap support was found for relationships between the major lineages within the Mollusca. LSU + SSU sequences also showed significant levels of rate heterogeneity between molluscan lineages. The Polyplacophora, Gastropoda, and Cephalopoda were each recovered as monophyletic clades with the LSU + SSU dataset. While the Bivalvia were not recovered as monophyletic clade in analyses of the SSU, LSU, or LSU + SSU, the Shimodaira-Hasegawa test showed that likelihood scores for these results did not differ significantly from topologies where the Bivalvia were monophyletic. Analyses of LSU sequences strongly contradict the widely accepted Diasoma hypotheses that bivalves and scaphopods are closely related to one another. The data are consistent with recent morphological and SSU analyses suggesting scaphopods are more closely related to gastropods and cephalopods than to bivalves. The dataset also presents the first published DNA sequences from a neomeniomorph aplacophoran, a group considered critical to our understanding of the origin and early radiation of the Mollusca.
Long-term human environmental impact: Land snail evidence from the Black Prairie of Mississippi, U.S.A. Peacock, Evan1 & Gerber, Jochen2* 1. Cobb Institute of Archaeology, P.O. Box AR, Mississippi State, MS 39762, USA. Email: Peacock@Soc.Msstate.Edu 2. Field Museum of Natural History, Department of Zoology (Invertebrates), 1400 S. Lake Shore Drive, Chicago, IL 60605-2496, USA. Email: jgerber@fieldmuseum.org The Black Prairie physiographic province of Mississippi and Alabama, southeastern U.S.A is a fragile landscape, with small, natural prairies developed on Cretaceous chalk bedrock. The prairie is home to a number of endangered plant and animal species, and efforts are underway to reconstruct habitats as they existed before extensive human environmental impact. These reconstruction efforts are hampered by different interpretations of historical data. To what extent did American Indian fires, agriculture, and other land-use activities affect the prairies? To what extent is the interspersed cedar-dominated tree cover reflective of past conditions? How much of the original prairies have been lost? To begin to address these questions, land snails from two archaeological sites in the Black Prairie are compared to modern samples taken from a variety of microhabitats. Modern prairie samples are dominated by Pupillidae, especially Pupoides albilabris and Gastrocopta procera/riparia; an unidentified species of Succinea also is common. Rabdotus dealbatus and Oligyra orbiculata are dominants in extremely eroded conditions. Modern cedar glade samples are similar in composition to the modern prairie fauna. Modern hardwood samples, however, are strikingly different, being dominated by Gastrocopta pentodon, Striatura meridionalis, Euconulus chersinus, and Glyphyalinia sp. The archaeological samples are distinct from all modern samples, being characterized by Hawaiia minuscula, Gastrocopta armifera and G. abbreviata, Helicodiscus notius/parallelus, and H. inermis. These results indicate that 1) the current cedar-dominated tree cover is a result of Historic-period erosion that probably began in the early 19th century; 2) prairie conditions today are in part a reflection of that impact; and 3) prehistorically, a different kind of anthropogenic landscape existed which has no modern analogues. The extent to which the archaeological assemblage represents prehistoric human modification of the landscape is currently under investigation.
A guide to indentification of freshwater and marine molluscs of Poland Piechocki, Andrzej1 & Wawrzyniak-Wydrowska, Brygida 2 1. Department of Invertebrate Zoology, University of Lodz, ul. S. Banacha 12/16, 90-237 Lodz, Poland; Email: piech@biol.uni.lodz.pl 2. Department of Palaeoceanology, University of Szczecin, ul. Waska 13, 71-415 Szczecin, Poland; Email: wydra@univ.szczecin.pl The authors embarked upon developing a modern guide, written in English, to identification of aquatic molluscs covering all the extant (and some subfossil) freshwater and Baltic species known from Poland. The guide will be amply illustrated by colour digital photographs of shells, processed with the computer image analysis programme LUCIA (Laboratory Imaging Ltd., Praha, Czech Republic). The species will be arranged according to the taxonomic system proposed by Falkner et al. (2001). Series of photographs will illustrate the diagnostic characters such as shape and sculpture of gastropod shells, shape of the aperture, structure of the operculum, etc. SEM images will additionally illustrate the bivalve hinge structure. In addition to the taxonomic part, the guide will contain a substantial general part dealing with morphology and anatomy of the Mollusca as well as with problems of their biology and ecology. Individual species will be characterised by descriptions of their shells and soft parts as well as variability thereof. The most important bionomic information and data on geographic distribution and occurrence in Poland will be supplied as well. Keys to the identification of orders, families, and genera will be developed. Species identification will be based on illustrations and descriptions. The taxonomic order will conform to the system proposed for the Fauna Europaea programme (5th Framework Programme of the European Union). The recent major changes in the molluscan taxonomy involve classification of pulmonates as well as numerous families within the Pulmonata, e.g., the Lymnaeidae and Planorbidae.
Phylogeography of a European land slug (Pulmonata, Arionidae): To what extent can Pleistocene glaciations explain the observed genetic structure? Pinceel, Jan1, Jordaens, Kurt1, Van Goethem, Jackie*2, & Backeljau, Thierry1,2 1 University of Antwerp, Evolutionary Biology Group, Groenenborgerlaan 171, B-2020 BelgiumAntwerp, Belgium, 2Royal Belgian Institute of Natural Sciences, Vautierstraat 29, B-1000 Brussels, Belgium. Email: jan.pinceel@ua.ac.be Arion fuscus (Müller) is a common and widespread member of the European terrestrial A. fuscus/subfuscus slug complex. As for many other land gastropods, A. fuscus is supposed to have low dispersal capacities. Hence, it may provide a good model to study the phylogeographic consequences of climatic changes in Europe. The 16S rDNA gene of approximately 960 specimens from 88 locations across its native distribution range were investigated with single stranded conformation polymorphism (SSCP) and sequence analysis. Nested clade analysis was used to discriminate between historic and demographic events. Two major phylogeographic regions were found, i.e. the Balkans and the remainder of Europe. Nucleotide diversities were very low in the northern parts of Europe, suggesting that single haplotypes colonized large areas and that most of the recently derived haplotypes have restricted distribution ranges suggesting that current gene flow is low. In the Alps, nucleotide diversities and the number of nested clades were much higher than in the remainder of Europe, suggesting that this area has the oldest, undisturbed A. fuscus populations which may have served as a source for postglacial recolonisation of northern areas. Hence, our results show that i) A. fuscus is a good colonizer instead of a poor disperser and ii) glacial refugia of A. fuscus are located in central Europe instead of southern Europe which is the main source of recolonisation for many (in)vertebrate species.
Old and new pupilloids from Pakistan Pokryszko, Beata M.*1, Auffenberg, Kurt2, Hlavá č, Jaroslav Č3 & Naggs, Fred41. Museum of Natural History, Wroc ław University, Sienkiewicza 21, 50-335 Wrocław, Poland. Email: bepok@biol.uni.wroc.pl2. University of Florida, Florida Museum of Natural History, Hull Road & 34th Street, Gainesville FL 32611-2710, USA 3. Institute of Geology AS CR, Laboratory of Environmental Geology, Rozvojova 135, CZ 165-02 Prague 6-Lysolaja, Czech Republic 4. Department of Zoology, The Natural History Museum, Cromwell Road, London SW7 5BD, UK Land snail material, collected in Pakistan in 1989-1994 (Auffenberg with co-workers), 1999 and 2001 (Hlavá č), included over 2000 specimens representing 16 species of Pupillidae, Vertiginidae and Gastrocoptinae: Pupilla muscorum (L.), P. turcmenica (O. Boettger), Vertigo antivertigo (Draparnaud), V. pseudosubstriata Lo˛ek, Vertigo n. sp. 1, Vertigo n. sp. 2, Truncatellina callicratis (Scacchi): ssp. callicratis and ssp. nov., T. himalayana (Benson), Truncatellina n. sp. 1, Truncatellina n. sp. 2, Columella n. sp., Gastrocopta theeli (Westerlund), G. avanica (Benson), Gastrocopta n. sp., Boysidia (Dasypupa) n. sp. and Boysia boysii (L. Pfeiffer). Ranges of 12 species are limited to the northernmost part of the country, three are distributed in the northern and central-western parts, one is found only in the south. The new species are known only from Pakistan. Among the remaining nine species, four have their main distribution ranges north of Pakistan (C and/or W Asia), two - west of Pakistan (India), and three are widely distributed (Palaearctic, Holarctic).
Geographical variation in the composition and richness of forest snail faunas in northern Europe Pokryszko, Beata M.*1 & Cameron, Robert A.D.2 1.Museum of Natural History, Wroc ław University, Sienkiewicza 21, 50-335 Wrocław, Poland. Email: bepok@biol.uni.wroc.pl |